콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU084801

Sigma-Aldrich

MISSION® esiRNA

targeting human ETS1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGAGACCTTCCAAGGACAGCCGTGTTGGTTGGACTCTGAATTTTGAATTGTTATTCTATTTTTTATTTTCCAGAACTCATTTTTTACCTTCAGGGGTGGGAGCTAAGTCAGTTGCAGCTGTAATCAATTGTGCGCAGTTGGGAAAGGAAAGCCAGGACTTGTGGGGTGGGTGGGACCAGAAATTCTTGAGCAAATTTTCAGGAGAGGGAGAAGGGCCTTCTCAGAAGCTTGAAGGCTCTGGCTTAACAGAGAAAGAGACTAATGTGTCCAATCATTTTTAAAAATCATCCATGAAAAAGTGTCTTGAGTTGTGGACCCATTAGCAAGTGACATTGTCACATCAGAACTCATGAAACTGATGTAAGGCAATTAATTTGCTTCTGTTTTTAGGTCTGGGAGGGC

Ensembl | 인체 수납 번호

ENSG00000134954

NCBI 수납 번호

NM_005238

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ETS1(2113) , ETS1(2113)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Huijie Gao et al.
Cancer letters, 354(2), 427-437 (2014-08-20)
We previously reported that β6 integrin played an important role in the progression of colon cancer. In this study, we demonstrated that β6 integrin induced the expression of MMP-3/MMP-9 and the invasion of colon cancer cells. Moreover, that function was
Haihong Liao et al.
Oncology reports, 40(4), 2389-2398 (2018-08-15)
An increasing number of studies have reported that microRNAs (miRNAs) are dysregulated in cervical cancer and serve critical roles in cervical oncogenesis and progression. Therefore, identifying the aberrantly expressed miRNAs implicated in the formation and progression of cervical cancer may
L Zhang et al.
European review for medical and pharmacological sciences, 23(5), 1986-1995 (2019-03-28)
MicroRNA-338-3p (miR-338-3p) was reported to influence the metastasis and development of several human cancers. However, in bladder cancer (BC), the special function of miR-338-3p remains unknown. Here, we aimed at exploring the miR-338-3p function in the progression of BC. miR-338-3p
X Zhao et al.
European review for medical and pharmacological sciences, 24(1), 181-188 (2020-01-21)
This study aims to detect microRNA-326 expression in nasopharyngeal carcinoma (NPC) tissues and cell lines and to explore the potential mechanism of microRNA-326 inhibiting the proliferative capacity and invasiveness of NPC cells. Quantitative Real Time-Polymerase Chain Reaction (qRT-PCR) was performed
Yutao Yang et al.
Molecular neurobiology, 54(6), 4421-4431 (2016-06-29)
Galanin receptor 2 (GAL2R) is a G protein-coupled receptor for the neuropeptide galanin that regulates many important physiological functions and pathological processes. To investigate the molecular mechanism governing GAL2R gene transcription, the rat GAL2R promoter was isolated and analyzed. We
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.