설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGCACTGAAACCCGAGTAAATGCTCAGGCTGCTGCATATGAATACATGGCTGCATACATAGAAAATGCAAAACAGGTTGGCCGCCTTGAAAATGCAATCGGGTGGTATCATAGCCACCCTGGCTATGGCTGCTGGCTTTCTGGGATTGATGTTAGTACTCAGATGCTCAATCAGCAGTTCCAGGAACCATTTGTAGCAGTGGTGATTGATCCAACAAGAACAATATCCGCAGGGAAAGTGAATCTTGGCGCCTTTAGGACATACCCAAAGGGCTACAAACCTCCTGATGAAGGACCTTCTGAGTACCAGACTATTCCACTTAATAAAATAGAAGATTTTGGTGTACACTGCAAACAATATTATGCCTTAGAAGTCTCATATTTCAAATCCTCTTTGGATCGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... COPS5(10987) , COPS5(10987)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
S Wang et al.
Oncogene, 35(47), 6096-6108 (2016-05-10)
Radiotherapy is the standard therapy for nasopharyngeal carcinoma (NPC); however, radioresistance can hinder successful treatment. Here we report that microRNA (miR)-24 acts as a tumor suppressor and radiosensitizer in NPC cells and xenografts by targeting Jab1/CSN5. Although accumulating evidence has
Yang Liu et al.
Acta pharmaceutica Sinica. B, 10(12), 2299-2312 (2020-12-24)
Programmed cell death-1 (PD-1)/programmed cell death ligand-1 (PD-L1) blocking therapy has become a major pillar of cancer immunotherapy. Compared with antibodies targeting, small-molecule checkpoint inhibitors which have favorable pharmacokinetics are urgently needed. Here we identified berberine (BBR), a proven anti-inflammation
Anja Schwarz et al.
Journal of biomedical science, 24(1), 12-12 (2017-02-09)
Oxidized low-density lipoprotein (oxLDL) mediates the transformation of macrophages (MΦ) to cholesterol-rich foam cells and the release of pro-inflammatory cytokines during atherogenesis. JAB1 (Jun activation domain binding protein-1) is present in all stages of human plaques, involved in the Toll-like
Sandra Jumpertz et al.
Cellular signalling, 34, 38-46 (2017-02-24)
The COP9 signalosome (CSN) is a multi-protein complex that is highly conserved in eukaryotes. Due to its regulatory impact on processes such as cell cycle, DNA damage response and apoptosis, the CSN is essential for mammalian cells. One of the
Michal Meir et al.
Nucleic acids research, 43(9), 4517-4530 (2015-04-10)
The DNA damage response is vigorously activated by DNA double-strand breaks (DSBs). The chief mobilizer of the DSB response is the ATM protein kinase. We discovered that the COP9 signalosome (CSN) is a crucial player in the DSB response and
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU084671-20UG | 4061828620401 |
| EHU084671-50UG | 4061828396368 |
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.