콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU084671

Sigma-Aldrich

MISSION® esiRNA

targeting human COPS5

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGCACTGAAACCCGAGTAAATGCTCAGGCTGCTGCATATGAATACATGGCTGCATACATAGAAAATGCAAAACAGGTTGGCCGCCTTGAAAATGCAATCGGGTGGTATCATAGCCACCCTGGCTATGGCTGCTGGCTTTCTGGGATTGATGTTAGTACTCAGATGCTCAATCAGCAGTTCCAGGAACCATTTGTAGCAGTGGTGATTGATCCAACAAGAACAATATCCGCAGGGAAAGTGAATCTTGGCGCCTTTAGGACATACCCAAAGGGCTACAAACCTCCTGATGAAGGACCTTCTGAGTACCAGACTATTCCACTTAATAAAATAGAAGATTTTGGTGTACACTGCAAACAATATTATGCCTTAGAAGTCTCATATTTCAAATCCTCTTTGGATCGC

Ensembl | 인체 수납 번호

ENSG00000121022

NCBI 수납 번호

NM_006837

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... COPS5(10987) , COPS5(10987)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

S Wang et al.
Oncogene, 35(47), 6096-6108 (2016-05-10)
Radiotherapy is the standard therapy for nasopharyngeal carcinoma (NPC); however, radioresistance can hinder successful treatment. Here we report that microRNA (miR)-24 acts as a tumor suppressor and radiosensitizer in NPC cells and xenografts by targeting Jab1/CSN5. Although accumulating evidence has
Yang Liu et al.
Acta pharmaceutica Sinica. B, 10(12), 2299-2312 (2020-12-24)
Programmed cell death-1 (PD-1)/programmed cell death ligand-1 (PD-L1) blocking therapy has become a major pillar of cancer immunotherapy. Compared with antibodies targeting, small-molecule checkpoint inhibitors which have favorable pharmacokinetics are urgently needed. Here we identified berberine (BBR), a proven anti-inflammation
Anja Schwarz et al.
Journal of biomedical science, 24(1), 12-12 (2017-02-09)
Oxidized low-density lipoprotein (oxLDL) mediates the transformation of macrophages (MΦ) to cholesterol-rich foam cells and the release of pro-inflammatory cytokines during atherogenesis. JAB1 (Jun activation domain binding protein-1) is present in all stages of human plaques, involved in the Toll-like
Sandra Jumpertz et al.
Cellular signalling, 34, 38-46 (2017-02-24)
The COP9 signalosome (CSN) is a multi-protein complex that is highly conserved in eukaryotes. Due to its regulatory impact on processes such as cell cycle, DNA damage response and apoptosis, the CSN is essential for mammalian cells. One of the
Michal Meir et al.
Nucleic acids research, 43(9), 4517-4530 (2015-04-10)
The DNA damage response is vigorously activated by DNA double-strand breaks (DSBs). The chief mobilizer of the DSB response is the ATM protein kinase. We discovered that the COP9 signalosome (CSN) is a crucial player in the DSB response and
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.