콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU084551

Sigma-Aldrich

MISSION® esiRNA

targeting human STMN1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TACACTGCCTGTCGCTTGTCTTCTATTCACCATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGAGAAGCGTGCCTCAGGCCAGGCTTTTGAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGTTCCAGAATTCCCCCTTTCCCCTCCAAAGAAGAAGGATCTTTCCCTGGAGGAAATTCAGAAGAAATTAGAAGCTGCAGAAGAAAGACGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCTGGCTGAGAAACGAGAGCACGAGAAAGAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAACTTCAGTAAAATGGCAGAAGAGAAACTGACCCACAAAATGGAAGCTAATAAAGAGAACCGAGAGGCACAAATGGCTGCCAAACTGGAACGTTTGCGAGAGAAGGATAAGCACATTGAAGAAGTGCGGAA

Ensembl | 인체 수납 번호

ENSG00000117632

NCBI 수납 번호

NM_203401

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... STMN1(3925) , STMN1(3925)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
SXU
KWU
XYS
PNS
QCS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Pinjie Bao et al.
Annals of surgical oncology, 24(13), 4017-4024 (2017-09-22)
Known as a microtubule-destabilizing protein, STMN1 (gene symbol: STMN1) regulates the dynamics of microtubules, cell cycle progress, and chemo-resistance against taxane agents. It is highly expressed in various human cancers and involved in cancer progression as well as poor prognosis.
Deepmala Shrestha et al.
Journal of cellular biochemistry, 119(2), 2381-2395 (2017-09-09)
Stathmin/oncoprotein18 regulates microtubule dynamics and participates in mitotic entry and exit. We isolated stathmin as a physically interacting partner of KIFC1, a minus-end-directed kinesin functioning in bipolar spindle formation and maintenance. We found that stathmin depletion leads to multipolar spindle
C M Fife et al.
Oncogene, 36(4), 501-511 (2016-06-21)
Neuroblastoma, the most common solid tumor of young children, frequently presents with aggressive metastatic disease and for these children the 5-year survival rates are dismal. Metastasis, the movement of cancer cells from one site to another, involves remodeling of the
Valerie B Sampson et al.
Oncotarget, 7(52), 86594-86607 (2016-11-20)
Osteosarcoma is the most frequently occurring bone cancer in children and adolescents. Unfortunately, treatment failures are common. Eribulin is a synthetic microtubule inhibitor that has demonstrated activity in preclinical osteosarcoma models. The effects of eribulin were evaluated in two human
W Feng et al.
Cancer gene therapy, 22(3), 115-121 (2015-01-13)
Paclitaxel (PTX) is broadly considered the drug of choice for treating human esophageal squamous cell cancer (ESCC). However, PTX resistance often ultimately leads to treatment failure. stathmin, or Op18, is a ubiquitously expressed 19-kDa cytosolic phosphoprotein that can integrate various
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.