콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU083211

Sigma-Aldrich

MISSION® esiRNA

targeting human TLE1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TCCTCGTCAGTGCTTAGCTGTGACATCTCTGTGGATGATAAGTACATAGTCACTGGCTCGGGGGACAAGAAGGCTACAGTCTATGAAGTCATCTACTGAAAACATTATGTGGTTTAACGTTTATAGTTGAATTGGGCCAAAATGTTTCGAATTTATAGAAATAGAAAAGTTGTAACTTTAAAAGAGAAAAAAAATTACAAACACCTGTTTCCAAACCTTGACAGAAAACTACTTTGAGTCTACAAAGAGGAGGCGACAAGTCCATCAGCAGAAAGTCACCTGTCTACATAGACCAAATGGAGCACCAAGGCCAAGCGGACAGAGGGGCCATGGGTTGTAGGATTGAGGAACGGAATCTGCCGACTCACATGACAGCCCATTCTTTCTTTCTGGGTGATCTGGG

Ensembl | 인체 수납 번호

ENSG00000196781

NCBI 수납 번호

NM_005077

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TLE1(7088) , TLE1(7088)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wei Chen et al.
Bioscience, biotechnology, and biochemistry, 84(6), 1176-1182 (2020-03-03)
Liver damage induced by ischemia/reperfusion (I/R) remains a primary issue in multiple hepatic surgeries. Innate immune-mediated inflammatory responses during the reperfusion stage aggravate the injury. Nevertheless, the detailed mechanism of hepatic I/R has not been fully clarified yet. Our research
Federica De Paoli et al.
FEBS letters, 590(1), 43-52 (2016-01-15)
Macrophages display heterogeneous phenotypes, including the classical M1 proinflammatory and the alternative M2 anti-inflammatory polarization states. The transducin-like enhancer of split-1 (TLE1) is a transcriptional corepressor whose functions in macrophages have not been studied yet. We report that TLE1 is
Xin Yao et al.
Oncotarget, 8(42), 72235-72249 (2017-10-27)
The Transducin-like enhancer of split 1 (TLE1) corepressor protein is overexpressed in human lung tumors and is a putative lung-specific oncogene. However, the molecular mechanism underlying its oncogenic function remains to be delineated. Here, we report an important role of
Xin Yao et al.
PloS one, 9(7), e101564-e101564 (2014-07-09)
The mitochondrial Bit1 (Bcl-2 inhibitor of transcription 1) protein is a part of an apoptotic pathway that is uniquely regulated by integrin-mediated attachment. As an anoikis effector, Bit1 is released into the cytoplasm following loss of cell attachment and induces

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.