설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GCATGGAAACATGGAGGAACAGTATTACAGTGTCCTACCACTCTAATCAAGAAAAGAATTACAGACTCTGATTCTACAGTGATGATTGAATTCTAAAAATGGTTATCATTAGGGCTTTTGATTTATAAAACTTTGGGTACTTATACTAAATTATGGTAGTTATTCTGCCTTCCAGTTTGCTTGATATATTTGTTGATATTAAGATTCTTGACTTATATTTTGAATGGGTTCTAGTGAAAAAGGAATGATATATTCTTGAAGACATCGATATACATTTATTTACACTCTTGATTCTACAATGTAGAAAATGAGGAAATGCCACAAATTGTATGGTGATAAAAGTCACGTGAAACAGAGTGATTGGTTGCATCCAGGCCTTTTGTCTTGGTGTTCATGATCTCCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... AMACR(23600) , C1QTNF3(23600)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Lei Chen et al.
Inflammation, 42(4), 1350-1359 (2019-03-20)
C1q/tumor necrosis factor-related protein-3 (CTRP3) is a novel, certified, adipokine that beneficially regulates metabolism and inflammation in the cardiovascular system. Atherosclerotic plaque rupturing and secondary thrombosis cause vascular disorders, such as myocardial infarction and unstable angina. However, the underlying role
Daniel W Youngstrom et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 38(5), 996-1006 (2019-12-07)
C1q/TNF-related protein 3 (CTRP3) is a cytokine known to regulate a variety of metabolic processes. Though previously undescribed in the context of bone regeneration, high throughput gene expression experiments in mice identified CTRP3 as one of the most highly upregulated
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.