콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU081481

Sigma-Aldrich

MISSION® esiRNA

targeting human MITF

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTGGGGTTTATTTCAGCAAACTTGTTGAATTTATTTTTAAGAAAGAAATACTGTATTGGGAAGTTACTGTTACTTGATAACAATGTTTTAACAAGAAGCAATGTTATAAAGTTAGTTTCAGTGCATTATCTACTTGTGTAGTCCTATGCAATAACAGTAGTGTTACATGTATCAAGCCTAGATGTTTTATACAGATGCCATATAGTGTTATGAGCCAGGCTGTTGAATGGAATTTCTCAGTAGCAGCCTACAACTGAATAGCAAGTGGCATAAAGCATATCCATTCAGAATGAAGTGCCTTAAATATAGCAGTAGTCTTTTTTGGACTAGCACTGACTGAACTGTAATGTAGGGGAAAGTTTCATGATGGTATCTATAGTCAAGACGAACATGTAGCATGGTGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jijun Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(2), 581-593 (2017-11-18)
Increasing evidence indicates that Huaier extract has promising therapeutic effects against cancer. However, the mechanisms that underlie its anti-tumor effects remain unclear. In recent years, various studies have shown that long noncoding RNAs (lncRNAs) play a critical role in the
Jing Wang et al.
Journal of cellular biochemistry, 119(11), 8862-8871 (2018-08-21)
Oral lichen planus (OLP) is a severe T cell-mediated disorder of the mucosa, which causes chronic inflammation. Forkhead box P3 (Foxp3) regulates the immune response and plays an important role in immunological diseases. The current study aimed to determine the
Paola Falletta et al.
Genes & development, 31(1), 18-33 (2017-01-18)
The intratumor microenvironment generates phenotypically distinct but interconvertible malignant cell subpopulations that fuel metastatic spread and therapeutic resistance. Whether different microenvironmental cues impose invasive or therapy-resistant phenotypes via a common mechanism is unknown. In melanoma, low expression of the lineage
Megha Rajasekhar et al.
Scientific reports, 8(1), 7264-7264 (2018-05-10)
Myelopoiesis involves differentiation of hematopoietic stem cells to cellular populations that are restricted in their self-renewal capacity, beginning with the common myeloid progenitor (CMP) and leading to mature cells including monocytes and granulocytes. This complex process is regulated by various
Hua Chen et al.
International journal of clinical and experimental pathology, 13(4), 730-737 (2020-05-02)
Coronary atherosclerosis affects human health all over the world. PON1 was found to be associated with coronary atherosclerosis but the specific mechanism is still unclear. Non-coding RNA plays an important role in many diseases. In recent years, studies have focused

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.