추천 제품
설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TTGGGGTTTATTTCAGCAAACTTGTTGAATTTATTTTTAAGAAAGAAATACTGTATTGGGAAGTTACTGTTACTTGATAACAATGTTTTAACAAGAAGCAATGTTATAAAGTTAGTTTCAGTGCATTATCTACTTGTGTAGTCCTATGCAATAACAGTAGTGTTACATGTATCAAGCCTAGATGTTTTATACAGATGCCATATAGTGTTATGAGCCAGGCTGTTGAATGGAATTTCTCAGTAGCAGCCTACAACTGAATAGCAAGTGGCATAAAGCATATCCATTCAGAATGAAGTGCCTTAAATATAGCAGTAGTCTTTTTTGGACTAGCACTGACTGAACTGTAATGTAGGGGAAAGTTTCATGATGGTATCTATAGTCAAGACGAACATGTAGCATGGTGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MITF(4286) , MITF(4286)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jijun Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 44(2), 581-593 (2017-11-18)
Increasing evidence indicates that Huaier extract has promising therapeutic effects against cancer. However, the mechanisms that underlie its anti-tumor effects remain unclear. In recent years, various studies have shown that long noncoding RNAs (lncRNAs) play a critical role in the
Jing Wang et al.
Journal of cellular biochemistry, 119(11), 8862-8871 (2018-08-21)
Oral lichen planus (OLP) is a severe T cell-mediated disorder of the mucosa, which causes chronic inflammation. Forkhead box P3 (Foxp3) regulates the immune response and plays an important role in immunological diseases. The current study aimed to determine the
Paola Falletta et al.
Genes & development, 31(1), 18-33 (2017-01-18)
The intratumor microenvironment generates phenotypically distinct but interconvertible malignant cell subpopulations that fuel metastatic spread and therapeutic resistance. Whether different microenvironmental cues impose invasive or therapy-resistant phenotypes via a common mechanism is unknown. In melanoma, low expression of the lineage
Megha Rajasekhar et al.
Scientific reports, 8(1), 7264-7264 (2018-05-10)
Myelopoiesis involves differentiation of hematopoietic stem cells to cellular populations that are restricted in their self-renewal capacity, beginning with the common myeloid progenitor (CMP) and leading to mature cells including monocytes and granulocytes. This complex process is regulated by various
Hua Chen et al.
International journal of clinical and experimental pathology, 13(4), 730-737 (2020-05-02)
Coronary atherosclerosis affects human health all over the world. PON1 was found to be associated with coronary atherosclerosis but the specific mechanism is still unclear. Non-coding RNA plays an important role in many diseases. In recent years, studies have focused
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.