콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU081461

Sigma-Aldrich

MISSION® esiRNA

targeting human AXL

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TGATCAATTATAGTTTCTGAGGCTTTATGATAATAGATTCTCTTGTATAAGATCCTAGATCCTAAGGGTCGAAAGCTCTAGAATCTGCAATTCAAAAGTTCCAAGAGTCTAAAGATGGAGTTTCTAAGGTCCGGTGTTCTAAGATGTGATATTCTAAGACTTACTCTAAGATCTTAGATTCTCTGTGTCTAAGATTCTAGATCAGATGCTCCAAGATTCTAGATGATTAAATAAGATTCTAACGGTCTGTTCTGTTTCAAGGCACTCTAGATTCCATTGGTCCAAGATTCCGGATCCTAAGCATCTAAGTTATAAGACTCTCACACTCAGTTGTGACTAACTAGACACCAAAGTTCTAATAATTTCTAATGTTGGACACCTTTAGGTTCTTTGCTGCATTCTGC

Ensembl | 인체 수납 번호

ENSG00000167601

NCBI 수납 번호

NM_021913

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... AXL(558) , AXL(558)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jeanne M Quinn et al.
Molecular cancer therapeutics, 18(2), 389-398 (2018-11-28)
Ovarian cancer, one of the deadliest malignancies in female cancer patients, is characterized by recurrence and poor response to cytotoxic chemotherapies. Fewer than 30% of patients with resistant disease will respond to additional chemotherapy treatments. This study aims to determine
Kei Namba et al.
Molecular cancer research : MCR, 17(2), 499-507 (2018-11-23)
Osimertinib (AZD9291) has an efficacy superior to that of standard EGFR-tyrosine kinase inhibitors for the first-line treatment of patients with EGFR-mutant advanced non-small cell lung cancer (NSCLC). However, patients treated with osimertinib eventually acquire drug resistance, and novel therapeutic strategies
Alexandra Blake et al.
Scientific reports, 7, 46525-46525 (2017-04-20)
Triple-negative breast cancer (TNBC) lacks the expression of estrogen receptor α, progesterone receptor and human epidermal growth factor receptor 2 (HER2). TNBC patients lack targeted therapies, as they fail to respond to endocrine and anti-HER2 therapy. Prognosis for this aggressive
Nellie K McDaniel et al.
Molecular cancer therapeutics, 17(11), 2297-2308 (2018-08-11)
The TAM (TYRO3, AXL, MERTK) family receptor tyrosine kinases (RTK) play an important role in promoting growth, survival, and metastatic spread of several tumor types. AXL and MERTK are overexpressed in head and neck squamous cell carcinoma (HNSCC), triple-negative breast
Laura M Divine et al.
Oncotarget, 7(47), 77291-77305 (2016-10-21)
The receptor tyrosine kinase AXL promotes migration, invasion, and metastasis. Here, we evaluated the role of AXL in endometrial cancer. High immunohistochemical expression of AXL was found in 76% (63/83) of advanced-stage, and 77% (82/107) of high-grade specimens and correlated
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.