콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU081271

Sigma-Aldrich

MISSION® esiRNA

targeting human CD276

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CAGACCACTGTGCAGCCTTATTTCTCCAATGGACATGATTCCCAAGTCATCCTGCTGCCTTTTTTCTTATAGACACAATGAACAGACCACCCACAACCTTAGTTCTCTAAGTCATCCTGCCTGCTGCCTTATTTCACAGTACATACATTTCTTAGGGACACAGTACACTGACCACATCACCACCCTCTTCTTCCAGTGCTGCGTGGACCATCTGGCTGCCTTTTTTCTCCAAAAGATGCAATATTCAGACTGACTGACCCCCTGCCTTATTTCACCAAAGACACGATGCATAGTCACCCCGGCCTTGTTTCTCCAATGGCCGTGATACACTAGTGATCATGTTCAGCCCTGCTTCCACCTGCATAGAATCTTTTCTTCTCAGACAGGGACAGTGCGGCCTCAACATCTCCTGGAGTCTAGAAGCTGTTTCCTTTCCCC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jingwen Zhang et al.
Laboratory investigation; a journal of technical methods and pathology, 99(8), 1117-1129 (2019-03-28)
B7H3 (CD276), a co-stimulator molecule of the cell surface B7 protein superfamily, is expressed on glioblastomas (GBM). Recently, B7H3 functions beyond immune costimulation have been demonstrated. However, the mechanisms underlying B7H3 function are diverse and not well understood. GBM tumors
Feifei Wang et al.
Cancer investigation, 32(6), 262-271 (2014-05-03)
B7-H3 has been detected in different cancers and correlated to tumor progression and outcome in cancer patients. In this study, we investigated the expression of B7-H3 in tissues and cells of primary hepatocellular carcinoma (PHC) patients. The research showed that
Wei Zhang et al.
OncoTargets and therapy, 8, 1721-1733 (2015-07-24)
The role of B7-H3 in acute monocytic leukemia U937 cells has not been thoroughly investigated. B7-H3 knockdown in the U937 cell line was performed using small hairpin (sh)RNA lentivirus transduction. The effects on cell proliferation, cycle, migration, and invasion were
Fu-Biao Kang et al.
Cancer cell international, 15, 45-45 (2015-04-25)
B7-homologue 3 (B7-H3), a recently identified immunoregulatory protein, has been shown to be overexpressed in human hepatocellular carcinoma (HCC). However, whether the dynamic expression pattern of B7-H3 contributes to early invasion of HCC is largely unknown. In addition, the biological

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.