콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU080971

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV6

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCCTATGGAGCAAGTTCTGCAGATGGTTCCAGAGACGGGAGTCCTGGGCCCAGAGCCGAGATGAGCAGAACCTGCTGCAGCAGAAGAGGATCTGGGAGTCTCCTCTCCTTCTAGCTGCCAAAGATAATGATGTCCAGGCCCTGAACAAGTTGCTCAAGTATGAGGATTGCAAGGTGCACCAGAGAGGAGCCATGGGGGAAACAGCGCTACACATAGCAGCCCTCTATGACAACCTGGAGGCCGCCATGGTGCTGATGGAGGCTGCCCCGGAGCTGGTCTTTGAGCCCATGACATCTGAGCTCTATGAGGGTCAGACTGCACTGCACATCGCTGTTGTGAACCAGAACATGAACCTGGTGCGAGCCCTGCTTGCCCGCAGGGCCAGTGTCTCTGCCAGAGCCACAGGCACTGCCTTCCGCCGTAGTCCCTGCAACCTCAT

Ensembl | 인체 수납 번호

ENSG00000165125

NCBI 수납 번호

NM_018646

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TRPV6(55503) , TRPV6(55503)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
RRT
ROT
STS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

M Skrzypski et al.
Biochimica et biophysica acta, 1853(12), 3202-3210 (2015-09-20)
Transient receptor potential channel vanilloid type 6 (TRPV6) is a non-selective cation channel with high permeability for Ca²⁺ ions. So far, the role of TRPV6 in pancreatic beta cells is unknown. In the present study, we characterized the role of
Cuiping Liu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 51(4), 1695-1709 (2018-12-07)
Parathyroid hormone-related protein (PTHrP) is implicated in regulating calcium homeostasis in vertebrates, including sea bream, chick, and mammals. However, the molecular mechanism underlying the function of PTHrP in regulating calcium transport is still not fully investigated. This study aimed to
Shigenori Miura et al.
Nature communications, 6, 8871-8871 (2015-11-14)
Microvilli are cellular membrane protrusions present on differentiated epithelial cells, which can sense and interact with the surrounding fluid environment. Biochemical and genetic approaches have identified a set of factors involved in microvilli formation; however, the underlying extrinsic regulatory mechanism
H Bond et al.
The Journal of physiology, 586(7), 2015-2025 (2008-02-09)
The role of parathyroid hormone-related protein (PTHrP) in fetal calcium homeostasis and placental calcium transport was examined in mice homozygous for the deletion of the PTHrP gene (PTHrP-/- null; NL) compared to PTHrP+/+ (wild-type; WT) and PTHrP+/- (heterozygous; HZ) littermates.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.