콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU078971

Sigma-Aldrich

MISSION® esiRNA

targeting human TFRC

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGCCAGCAAAGTTGAGAAACTCACTTTAGACAATGCTGCTTTCCCTTTCCTTGCATATTCTGGAATCCCAGCAGTTTCTTTCTGTTTTTGCGAGGACACAGATTATCCTTATTTGGGTACCACCATGGACACCTATAAGGAACTGATTGAGAGGATTCCTGAGTTGAACAAAGTGGCACGAGCAGCTGCAGAGGTCGCTGGTCAGTTCGTGATTAAACTAACCCATGATGTTGAATTGAACCTGGACTATGAGAGGTACAACAGCCAACTGCTTTCATTTGTGAGGGATCTGAACCAATACAGAGCAGACATAAAGGAAATGGGCCTGAGTTTACAGTGGCTGTATTCTGCTCGTGGAGACTTCTTCCGTGCTACTTCCAGACTAACAACAGATTTCGGGAATGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jason W Dang et al.
Cell reports, 27(12), 3618-3628 (2019-06-20)
Zika virus (ZIKV) infection is implicated in severe fetal developmental disorders, including microcephaly. MicroRNAs (miRNAs) post-transcriptionally regulate numerous processes associated with viral infection and neurodegeneration, but their contribution to ZIKV pathogenesis is unclear. We analyzed the mRNA and miRNA transcriptomes of human
Hongwei Su et al.
Molecular cancer, 18(1), 27-27 (2019-02-21)
Circular RNA (circRNA) represents a broad and diverse endogenous RNAs that can regulate gene expression in cancer. However, the regulation and function of bladder cancer (BC) circRNAs remain largely unknown. Here we generated circRNA microarray data from three BC tissues
Yihe Wu et al.
Thoracic cancer, 9(2), 253-261 (2017-12-30)
Transferrin receptor (TfR) is expressed in most lung cancers and is an indicator of poor prognosis in certain groups of patients. In this study, we blocked cell surface TfR to inhibit lung adenocarcinoma (LAC) cell growth in vitro and investigated
Xinjian Lin et al.
Oncoscience, 1(3), 185-195 (2015-01-17)
The αV integrin is expressed in most cancer cells where it regulates a diverse array of cellular functions essential to the initiation, progression and metastasis of solid tumors. However, little is known about how αV integrin modulates cellular sensitivity to
Julie Mazzolini et al.
The Biological bulletin, 231(1), 40-60 (2016-09-18)
Particles present in diesel exhaust have been proposed as a significant contributor to the development of acute and chronic lung diseases, including respiratory infection and allergic asthma. Nanoceria (CeO2 nanoparticles) are used to increase fuel efficiency in internal combustion engines

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.