콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU077841

Sigma-Aldrich

MISSION® esiRNA

targeting human LARP1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGCTACCGAAAGTTTGATGGTGTGGAGGGGCCTCGTACGCCCAAGTACATGAACAACATCACCTACTACTTTGACAATGTCAGCAGCACCGAGCTTTACAGTGTGGATCAGGAACTGCTCAAAGACTACATCAAGCGCCAGATTGAATACTACTTCAGCGTGGACAATTTAGAGCGAGACTTCTTCCTGCGAAGGAAAATGGATGCTGATGGTTTCCTACCCATCACCCTTATTGCTTCCTTCCACCGAGTGCAGGCCCTTACCACTGACATTTCACTCATCTTTGCGGCCCTAAAGGACAGCAAGGTGGTGGAGATCGTTGATGAGAAAGTTCGTAGGAGGGAGGAACCAGAAAAGTGGCCTCTTCCCCCAATAGTGGATTATTCACAGACTGATTTCTCCCAGC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Johannes H Wilbertz et al.
Molecular cell, 73(5), 946-958 (2019-01-22)
Biological phase transitions form membrane-less organelles that generate distinct cellular environments. How molecules are partitioned between these compartments and the surrounding cellular space and the functional consequence of this localization is not well understood. Here, we report the localization of
Marie-Laure Plissonnier et al.
Virus research, 271, 197679-197679 (2019-08-10)
Hepatitis C virus (HCV) virions contain a subset of host liver cells proteome often composed of interesting virus-interacting factors. A proteomic analysis performed on double gradient-purified clinical HCV highlighted the translation regulator LARP1 on these virions. This finding was validated
Ewan M Smith et al.
Nucleic acids research, 49(1), 458-478 (2020-12-18)
The mammalian target of rapamycin (mTOR) is a critical regulator of cell growth, integrating multiple signalling cues and pathways. Key among the downstream activities of mTOR is the control of the protein synthesis machinery. This is achieved, in part, via
Maria Dermit et al.
Developmental cell, 55(3), 298-313 (2020-11-11)
Translation of ribosomal protein-coding mRNAs (RP-mRNAs) constitutes a key step in ribosome biogenesis, but the mechanisms that modulate RP-mRNA translation in coordination with other cellular processes are poorly defined. Here, we show that subcellular localization of RP-mRNAs acts as a

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.