설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGCTACCGAAAGTTTGATGGTGTGGAGGGGCCTCGTACGCCCAAGTACATGAACAACATCACCTACTACTTTGACAATGTCAGCAGCACCGAGCTTTACAGTGTGGATCAGGAACTGCTCAAAGACTACATCAAGCGCCAGATTGAATACTACTTCAGCGTGGACAATTTAGAGCGAGACTTCTTCCTGCGAAGGAAAATGGATGCTGATGGTTTCCTACCCATCACCCTTATTGCTTCCTTCCACCGAGTGCAGGCCCTTACCACTGACATTTCACTCATCTTTGCGGCCCTAAAGGACAGCAAGGTGGTGGAGATCGTTGATGAGAAAGTTCGTAGGAGGGAGGAACCAGAAAAGTGGCCTCTTCCCCCAATAGTGGATTATTCACAGACTGATTTCTCCCAGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... LARP1(23367) , LARP1(23367)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Johannes H Wilbertz et al.
Molecular cell, 73(5), 946-958 (2019-01-22)
Biological phase transitions form membrane-less organelles that generate distinct cellular environments. How molecules are partitioned between these compartments and the surrounding cellular space and the functional consequence of this localization is not well understood. Here, we report the localization of
Marie-Laure Plissonnier et al.
Virus research, 271, 197679-197679 (2019-08-10)
Hepatitis C virus (HCV) virions contain a subset of host liver cells proteome often composed of interesting virus-interacting factors. A proteomic analysis performed on double gradient-purified clinical HCV highlighted the translation regulator LARP1 on these virions. This finding was validated
Ewan M Smith et al.
Nucleic acids research, 49(1), 458-478 (2020-12-18)
The mammalian target of rapamycin (mTOR) is a critical regulator of cell growth, integrating multiple signalling cues and pathways. Key among the downstream activities of mTOR is the control of the protein synthesis machinery. This is achieved, in part, via
Maria Dermit et al.
Developmental cell, 55(3), 298-313 (2020-11-11)
Translation of ribosomal protein-coding mRNAs (RP-mRNAs) constitutes a key step in ribosome biogenesis, but the mechanisms that modulate RP-mRNA translation in coordination with other cellular processes are poorly defined. Here, we show that subcellular localization of RP-mRNAs acts as a
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.