설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCAAAGGATCTTCCCAAGCATTGCCTCTATACCAGACTCAGTTCACTGCAAAAATTAAAGGAACATCTAGTCTTCACAGTATGTTTATCATATCAGTACTCAGGATTGGAAGATACTGTAGAGGACAAGCAGGAAGTGAATGTTGGGAAACCTCTCATTGCTAAATTAGACATGCATCGAGGTTTGGGAAGGAAGACTTGCTTTCAAACTTGTCTTATGTCTAATGGTCCTTACCAGAGTTCTGCAGCCACCTCAGGAGGAGCAGGGCATTATCACTCATTGCAAGACCCATTCCATGGTGTTTACCATTCACATCCTGGTAATCCAAGTAATGTTACACCAGCAGATAGCTGTCATTGCAGCCGGACTCCAGATGCATTTATTTCAAGTTTCGCTCACCATGCTT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... MALT1(10892) , MALT1(10892)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Leonie Konczalla et al.
International journal of cancer, 146(6), 1618-1630 (2019-07-11)
MALT1 is a key mediator of NF-κB signaling and a main driver of B-cell lymphomas. Remarkably, MALT1 is expressed in the majority of pancreatic ductal adenocarcinomas (PDACs) as well, but absent from normal exocrine pancreatic tissue. Following, MALT1 shows off
Matija Hedl et al.
Proceedings of the National Academy of Sciences of the United States of America, 111(37), 13451-13456 (2014-09-10)
Inflammatory diseases are characterized by dysregulated cytokine production. Altered functions for most risk loci, including the inflammatory bowel disease and leprosy-associated tumor necrosis factor ligand superfamily member 15 (TNFSF15) region, are unclear. Regulation of pattern-recognition-receptor (PRR)-induced signaling and cytokines is
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU077701-20UG | 4061831363081 |
| EHU077701-50UG | 4061828401208 |
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.