콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU077661

Sigma-Aldrich

MISSION® esiRNA

targeting human SPP1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAAGCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTCCAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGTAGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGATAGTGCATCTTCTGAGGTCAATTAAAAGGAGAAAAAATACAATTTCTCACTTTGCATTTAGTCAAAAGAAAAAATGCTTTATAGCAAAATGAAAGAGAACATGAAATGCTTCTTTCTCAGTTTATTGGTTGAATGTGTATCTATTTGAGTCTGGAAATAACTAATGTGTTTGATAATTAGTTTAGTTTGTGGCTTCATGGAAACTCC

Ensembl | 인체 수납 번호

ENSG00000118785

NCBI 수납 번호

NM_000582

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SPP1(6696) , SPP1(6696)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
BAV
RXU
QBS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Yao Fan et al.
Bone research, 8, 9-9 (2020-03-05)
Osteocytes are mechanosensitive bone cells, but little is known about their effects on tumor cells in response to mechanical stimulation. We treated breast cancer cells with osteocyte-derived conditioned medium (CM) and fluid flow-treated conditioned medium (FFCM) with 0.25 Pa and 1 Pa
Beibei Zhang et al.
Experimental and therapeutic medicine, 20(4), 3633-3642 (2020-08-29)
The metastatic behavior of hepatocellular carcinoma (HCC) is one of the key factors that leads to poor prognosis. The aim of the current study was to determine the changes in metastasis and the proliferation potential of bone marrow mesenchymal stem
Sheng-Li Hu et al.
Molecular neurobiology, 52(1), 236-243 (2014-08-26)
Neurosurgical operations may result in surgical injury which would lead to postoperative neurological deficits. Hyperbaric oxygen preconditioning (HBO-PC) may be beneficial for such people. However, the exact mechanism underlying HBO-PC is not well known yet. The aim of this study
Huan Yu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 35(3), e21405-e21405 (2021-02-10)
Microglia activation and release of pro-inflammatory cytokines have been closely linked to glaucoma. However, the mechanisms that initiate these pathways remain unclear. Here, we investigated the role of a pro-inflammatory cytokine--osteopontin (OPN), in retinal microglia activation process along with the
Iman A Mohamed et al.
PloS one, 10(4), e0123318-e0123318 (2015-04-18)
Enhanced expression and activity of the Na+/H+ exchanger isoform 1 (NHE1) has been implicated in cardiomyocyte hypertrophy in various experimental models. The upregulation of NHE1 was correlated with an increase in osteopontin (OPN) expression in models of cardiac hypertrophy (CH)
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.