설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
AATGTGGCCAAGACAGAACCAGTCAGCATTCTACAACCCCAGACCACCGTTAATCCAGATCGCATCAAACAAACATTGCCATCTTCCCCAACTACCACCAAGTCCTCTCCATCTGATCCCATGACCACCTCCAGAGCTAATCAGGTAAAGATTATAGTTCCCAACAGCACAGCAGGTCTGATAATAGGGAAGGGAGGTGCTACTGTGAAGGCTGTAATGGAGCAGTCAGGGGCTTGGGTGCAGCTTTCCCAGAAACCTGATGGGATCAACTTGCAAGAGAGGGTTGTCACTGTGAGTGGAGAACCTGAACAAAACCGAAAAGCTGTTGAACTTATCATCCAGAAGATACAAGAGGATCCACAAAGTGGCAGCTGTCTCAATATCAGTTATGCCAATGTGACAGGTCCAGTGGCAAATTCCAATCCAACCGGATCTCCTTATG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NOVA1(4857) , NOVA1(4857)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Journal of cellular and molecular medicine, 22(5), 2622-2630 (2018-03-03)
Increasing studies have suggested that dysregulation of RNA-binding proteins (RBPs) contributes to cancer progression. Neuro-oncological ventral antigen 1 (NOVA1) is a novel RBP and plays an important role in tumour development. However, the expression and role of NOVA1 in melanoma
PloS one, 9(10), e109124-e109124 (2014-10-10)
MicroRNAs (miRNAs) are small, short noncoding RNAs that modulate the expression of numerous genes by targeting their mRNA. Numerous abnormal miRNA expression patterns are observed in various human malignancies, and certain miRNAs can act as oncogenes or tumor suppressors. Astrocytoma
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.