설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GGAGTGGAGTCAGCCATCTCTAGTTTAGACTACATTTCTAAGACAAAAGAAGATGTCAAACTGAAATTAGAGGAATGTTCCAAAAGAGCAAATAATGGGAAATTTACTCTTCGAGACTTGCTTGTGGTTCCTATGCAACGTGTTTTAAAGTACCACCTTCTCCTCCAGGAACTGGTCAAACATACCACTGATCCGACTGAGAAGGCAAATCTGAAACTGGCTCTTGATGCCATGAAGGACTTGGCACAATATGTGAATGAAGTGAAAAGAGATAATGAGACCCTTCGTGAAATTAAACAGTTTCAGCTATCTATAGAGAATTTGAACCAACCAGTTTTGCTTTTTGGACGACCTCAGGGAGATGGTGAAATTCGAATAACCACTCTAGACAAGCATACCAAACAAGAAAGGCATATCTTCTTATTTGATTTGGCAGTGATCGT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... VAV3(10451) , VAV3(10451)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Takeo Nomura et al.
Molecular cancer, 12, 27-27 (2013-04-10)
The Vav family of Rho/Rac guanosine nucleotide exchange factors comprises three members in mammalian cells. Vav3 enhances androgen receptor (AR) activity during progression to androgen independence in prostate cancer. We examined Vav3 small interfering RNA (siRNA) effects on cell proliferation
Jie Sha et al.
Endocrinology and metabolism (Seoul, Korea), 29(3), 363-370 (2014-10-14)
The role of small GTPase molecules is poorly understood under high glucose conditions. We analyzed the expression pattern of Vav3 in skeletal muscle C2C12 cells under high glucose culture condition with reverse transcription-polymerase chain reaction and Western blot analysis. We
J K Liu et al.
Cell death and differentiation, 21(8), 1325-1339 (2014-05-17)
Glioblastoma is the most common primary intrinsic brain tumor and remains incurable despite maximal therapy. Glioblastomas display cellular hierarchies with self-renewing glioma-initiating cells (GICs) at the apex. To discover new GIC targets, we used in vivo delivery of phage display
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.