콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU076261

Sigma-Aldrich

MISSION® esiRNA

targeting human ABCC1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CGGATGTCATCTGAAATGGAAACCAACATCGTGGCCGTGGAGAGGCTCAAGGAGTATTCAGAGACTGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGAATTCCGGAACTACTGCCTGCGCTACCGAGAGGACCTGGACTTCGTTCTCAGGCACATCAATGTCACGATCAATGGGGGAGAAAAGGTCGGCATCGTGGGGCGGACGGGAGCTGGGAAGTCGTCCCTGACCCTGGGCTTATTTCGGATCAACGAGTCTGCCGAAGGAGAGATCATCATCGATGGCATCAACATCGCCAAGATCGGCCTGCACGACCTCCGCTTCAAGATCACCATCATCCCCCAGGACCCTGTTTTGTTTTCGGGTTCCCT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

F Anthony Willyerd et al.
Journal of neurotrauma, 33(2), 226-231 (2015-04-22)
Adenosine triphosphate-binding cassette (ABC) transport proteins ABCC1 and ABCB1 (also known as multidrug resistance-associated protein 1 and p-glycoprotein, respectively), are key membrane efflux transporters of drugs and endogenous substrates, including in the brain. The impact of traumatic brain injury (TBI)
Yan Li et al.
Journal of molecular histology, 46(4-5), 357-364 (2015-06-21)
Multidrug resistance-associated protein 1 (MRP1) belongs to ATP-binding cassette transporters family. The overexpression of MRP1 is predominantly related with the failure of chemo-radiotherapy in various tumors. However, its possible role in hypertrophic scar (HS) is hardly investigated. Here we showed
M Hasanzadeh Kafshgari et al.
Biomaterials science, 3(12), 1555-1565 (2015-09-08)
In this study, thermally hydrocarbonised porous silicon nanoparticles (THCpSiNPs) capped with polyethylenimine (PEI) were fabricated, and their potential for small interfering RNA (siRNA) delivery was investigated in an in vitro glioblastoma model. PEI coating following siRNA loading enhanced the sustained

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.