설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CGGATGTCATCTGAAATGGAAACCAACATCGTGGCCGTGGAGAGGCTCAAGGAGTATTCAGAGACTGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGAATTCCGGAACTACTGCCTGCGCTACCGAGAGGACCTGGACTTCGTTCTCAGGCACATCAATGTCACGATCAATGGGGGAGAAAAGGTCGGCATCGTGGGGCGGACGGGAGCTGGGAAGTCGTCCCTGACCCTGGGCTTATTTCGGATCAACGAGTCTGCCGAAGGAGAGATCATCATCGATGGCATCAACATCGCCAAGATCGGCCTGCACGACCTCCGCTTCAAGATCACCATCATCCCCCAGGACCCTGTTTTGTTTTCGGGTTCCCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ABCC1(4363) , ABCC1(4363)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Journal of neurotrauma, 33(2), 226-231 (2015-04-22)
Adenosine triphosphate-binding cassette (ABC) transport proteins ABCC1 and ABCB1 (also known as multidrug resistance-associated protein 1 and p-glycoprotein, respectively), are key membrane efflux transporters of drugs and endogenous substrates, including in the brain. The impact of traumatic brain injury (TBI)
Journal of molecular histology, 46(4-5), 357-364 (2015-06-21)
Multidrug resistance-associated protein 1 (MRP1) belongs to ATP-binding cassette transporters family. The overexpression of MRP1 is predominantly related with the failure of chemo-radiotherapy in various tumors. However, its possible role in hypertrophic scar (HS) is hardly investigated. Here we showed
Biomaterials science, 3(12), 1555-1565 (2015-09-08)
In this study, thermally hydrocarbonised porous silicon nanoparticles (THCpSiNPs) capped with polyethylenimine (PEI) were fabricated, and their potential for small interfering RNA (siRNA) delivery was investigated in an in vitro glioblastoma model. PEI coating following siRNA loading enhanced the sustained
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.