설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
TCACAACCTCACCTTCCACAAGCTGGTGGCCTATATGATCTGCCTACATACAGCTATTCACATCATTGCACACCTGTTTAACTTTGACTGCTATAGCAGAAGCCGACAGGCCACAGATGGCTCCCTTGCCTCCATTCTCTCCAGCCTATCTCATGATGAGAAAAAGGGGGGTTCTTGGCTAAATCCCATCCAGTCCCGAAACACGACAGTGGAGTATGTGACATTCACCAGCATTGCTGGTCTCACTGGAGTGATCATGACAATAGCCTTGATTCTCATGGTAACTTCAGCTACTGAGTTCATCCGGAGGAGTTATTTTGAAGTCTTCTGGTATACTCACCACCTTTTTATCTTCTATATCCTTGGCTTAGGGATTCACGGCATTGGTGGAATTGTCCGGGGTCAAACAGAGGAGAGCATGAATGAGAGTCATCCTCGCAAGTGTG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... NOX1(27035) , NOX1(27035)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
PLoS pathogens, 12(1), e1005382-e1005382 (2016-01-14)
Generation of reactive oxygen species (ROS) during infection is an immediate host defense leading to microbial killing. APE1 is a multifunctional protein induced by ROS and after induction, protects against ROS-mediated DNA damage. Rac1 and NAPDH oxidase (Nox1) are important
International journal of molecular sciences, 20(6) (2019-03-25)
Excessive bone resorption by osteoclasts causes bone loss-related diseases and reactive oxygen species (ROS) act as second messengers in intercellular signaling pathways during osteoclast differentiation. In this study, we explored the protective effects of fermented oyster extract (FO) against receptor
European review for medical and pharmacological sciences, 20(21), 4474-4481 (2016-11-23)
Reactive oxygen species (ROS) generated by endogenous metabolic enzymes are involved in a variety of pathology processes, including cancer. In particular, superoxide-generating NADPH oxidase 1 (Nox1), a member of Nox enzyme family, is highly expressed in the colon tissue and
The nuclear receptor NOR-1 modulates redox homeostasis in human vascular smooth muscle cells.
Journal of molecular and cellular cardiology, 122, 23-33 (2018-08-11)
Oncotarget, 8(61), 103710-103730 (2017-12-22)
Oxaliplatin is a major treatment for metastatic colorectal cancer, however its effectiveness is greatly diminished by the development of resistances. Our previous work has shown that oxaliplatin efficacy depends on the reactive oxygen species (ROS) produced by Nox1. In this
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.