콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU075891

Sigma-Aldrich

MISSION® esiRNA

targeting human SOD2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GTTGGCCAAGGGAGATGTTACAGCCCAGATAGCTCTTCAGCCTGCACTGAAGTTCAATGGTGGTGGTCATATCAATCATAGCATTTTCTGGACAAACCTCAGCCCTAACGGTGGTGGAGAACCCAAAGGGGAGTTGCTGGAAGCCATCAAACGTGACTTTGGTTCCTTTGACAAGTTTAAGGAGAAGCTGACGGCTGCATCTGTTGGTGTCCAAGGCTCAGGTTGGGGTTGGCTTGGTTTCAATAAGGAACGGGGACACTTACAAATTGCTGCTTGTCCAAATCAGGATCCACTGCAAGGAACAACAGGCCTTATTCCACTGCTGGGGATTGATGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAATGTCAGGCCTGATTATCTAAAAGCTATTTGGAATGTAATCAACTGGGAGAATGTAACTGAAAGATACATGGCTTGCA

Ensembl | 인체 수납 번호

ENSG00000112096

NCBI 수납 번호

NM_000636

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... SOD2(6648) , SOD2(6648)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
YIU
QCS
HUT
QQT
ZAS

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Miyoung Lee et al.
Antioxidants (Basel, Switzerland), 9(1) (2020-01-17)
Umbilical cord blood-derived mesenchymal stem cells (UCB-MSCs) are accessible, available in abundance, and have been shown to be a promising source that can regenerate cartilage in patients with osteoarthritis or other orthopedic diseases. Recently, a three-dimensional (3D) cell culture system
Brianna M Young et al.
Molecular therapy. Methods & clinical development, 14, 113-125 (2019-07-25)
Age-related macular degeneration (AMD) has been linked to oxidative damage and para-inflammation, an activation of inflammasome signaling in the retinal pigment epithelium (RPE) and the underlying choriocapillaris. Herein, we tested the efficacy of a gene-delivered caspase-1 inhibitor in controlling the
Veronica Nobile et al.
Human genetics, 139(2), 227-245 (2020-01-11)
Fragile X-related disorders are due to a dynamic mutation of the CGG repeat at the 5' UTR of the FMR1 gene, coding for the RNA-binding protein FMRP. As the CGG sequence expands from premutation (PM, 56-200 CGGs) to full mutation
You Dong Liu et al.
International journal of cancer, 144(12), 3056-3069 (2018-12-12)
Toll-like receptors (TLRs) play critical roles in host defense after recognition of conserved microbial- and host-derived components, and their dysregulation is a common feature of various inflammation-associated cancers, including gastric cancer (GC). Despite the recent recognition that metabolic reprogramming is
Serena Sagliocchi et al.
Redox biology, 24, 101228-101228 (2019-06-04)
Thyroid hormone (TH) is a key metabolic regulator that acts by coordinating short- and long-term energy needs. Accordingly, significant metabolic changes are observed depending on thyroid status. Although it is established that hyperthyroidism augments basal energy consumption, thus resulting in
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.