콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU074371

Sigma-Aldrich

MISSION® esiRNA

targeting human DRD2

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GAGCTGGAGATGGAGATGCTCTCCAGCACCAGCCCACCCGAGAGGACCCGGTACAGCCCCATCCCACCCAGCCACCACCAGCTGACTCTCCCCGACCCGTCCCACCATGGTCTCCACAGCACTCCCGACAGCCCCGCCAAACCAGAGAAGAATGGGCATGCCAAAGACCACCCCAAGATTGCCAAGATCTTTGAGATCCAGACCATGCCCAATGGCAAAACCCGGACCTCCCTCAAGACCATGAGCCGTAGGAAGCTCTCCCAGCAGAAGGAGAAGAAAGCCACTCAGATGCTCGCCATTGTTCTCGGCGTGTTCATCATCTGCTGGCTGCCCTTCTTCATCACACACATCCTGAACATACACTGTGACTGCAACATCCCGCCTGTCCTGTACAGCGCCTTCACGTGGCTGGGCTATGTCAACAGCGCCGTGAACCCCATCATCTACA

Ensembl | 인체 수납 번호

ENSG00000149295

NCBI 수납 번호

NM_016574

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... DRD2(1813) , DRD2(1813)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
QCS
DOR

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Hongli Huang et al.
International immunopharmacology, 39, 113-120 (2016-07-29)
Dopamine (DA), an important neurotransmitter, has been reported to play a negative role in tumor progression. DA acts its role via dopamine receptors (DRs), which can be divided into five receptor subtypes (D1R-D5R). Among these receptor subtypes, D2R has been
Carole Deyts et al.
PloS one, 4(12), e8287-e8287 (2009-12-18)
Huntington's disease (HD) is a polyglutamine-expanded related neurodegenerative disease. Despite the ubiquitous expression of expanded, polyQ-Huntingtin (ExpHtt) in the brain, striatal neurons present a higher susceptibility to the mutation. A commonly admitted hypothesis is that Dopaminergic inputs participate to this
N Shioda et al.
Molecular psychiatry, 22(8), 1205-1222 (2016-12-07)
Aberrant dopamine D
Yanrong Zhang et al.
PloS one, 7(6), e38745-e38745 (2012-06-22)
Renal dopamine receptors participate in the regulation of blood pressure. Genetic factors, including polymorphisms of the dopamine D(2) receptor gene (DRD2) are associated with essential hypertension, but the mechanisms of their contribution are incompletely understood. Mice lacking Drd2 (D(2)-/-) have
Fei Han et al.
Scientific reports, 9(1), 16861-16861 (2019-11-16)
The Wnt/β-catenin pathway is one of the most conserved signaling pathways across species with essential roles in development, cell proliferation, and disease. Wnt signaling occurs at the protein level and via β-catenin-mediated transcription of target genes. However, little is known
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.