설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
GCAGTACCCACTGGAAGGACTTAGGCGCTCGCGTGGACACCGCAAGCCCCTCAGTAGCCTCGGCCCAAGAGGCCTGCTTTCCACTCGCTAGCCCCGCCGGGGGTCCGTGTCCTGTCTCGGTGGCCGGACCCGGGCCCGAGCCCGAGCAGTAGCCGGCGCCATGTCGGTGGTGGGCATAGACCTGGGCTTCCAGAGCTGCTACGTCGCTGTGGCCCGCGCCGGCGGCATCGAGACTATCGCTAATGAGTATAGCGACCGCTGCACGCCGGCTTGCATTTCTTTTGGTCCTAAGAATCGTTCAATTGGAGCAGCAGCTAAAAGCCAGGTAATTTCTAATGCAAAGAACACAGTCCAAGGATTTAAAAGATTCCATGGCCGAGCATTCTCTGATCCATTTGTGGAGGCAGAA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HSPA4(3308) , HSPA4(3308)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
PloS one, 10(6), e0129343-e0129343 (2015-06-13)
Exposure of pulmonary artery endothelial cells (PAECs) to hyperoxia results in a compromise in endothelial monolayer integrity, an increase in caspase-3 activity, and nuclear translocation of apoptosis-inducing factor (AIF), a marker of caspase-independent apoptosis. In an endeavor to identify proteins
Histochemistry and cell biology, 144(2), 179-184 (2015-05-09)
Ubiquitin-proteasome system (UPS) proteins and proteolytic activity are localized in a recently identified cytoplasmic structure characterized by accumulation of barrel-like particles, which is known as the particulate cytoplasmic structure (PaCS). PaCSs have been detected in neoplastic, preneoplastic, chronically infected, and
Journal of immunology (Baltimore, Md. : 1950), 193(4), 1975-1987 (2014-07-16)
Binge or moderate alcohol exposure impairs host defense and increases susceptibility to infection because of compromised innate immune responses. However, there is a lack of consensus on the molecular mechanism by which alcohol mediates this immunosuppression. In this study, we
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.