콘텐츠로 건너뛰기
Merck
모든 사진(1)

문서

EHU073271

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA4

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GCAGTACCCACTGGAAGGACTTAGGCGCTCGCGTGGACACCGCAAGCCCCTCAGTAGCCTCGGCCCAAGAGGCCTGCTTTCCACTCGCTAGCCCCGCCGGGGGTCCGTGTCCTGTCTCGGTGGCCGGACCCGGGCCCGAGCCCGAGCAGTAGCCGGCGCCATGTCGGTGGTGGGCATAGACCTGGGCTTCCAGAGCTGCTACGTCGCTGTGGCCCGCGCCGGCGGCATCGAGACTATCGCTAATGAGTATAGCGACCGCTGCACGCCGGCTTGCATTTCTTTTGGTCCTAAGAATCGTTCAATTGGAGCAGCAGCTAAAAGCCAGGTAATTTCTAATGCAAAGAACACAGTCCAAGGATTTAAAAGATTCCATGGCCGAGCATTCTCTGATCCATTTGTGGAGGCAGAA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Dmitry Kondrikov et al.
PloS one, 10(6), e0129343-e0129343 (2015-06-13)
Exposure of pulmonary artery endothelial cells (PAECs) to hyperoxia results in a compromise in endothelial monolayer integrity, an increase in caspase-3 activity, and nuclear translocation of apoptosis-inducing factor (AIF), a marker of caspase-independent apoptosis. In an endeavor to identify proteins
Alessandro Vanoli et al.
Histochemistry and cell biology, 144(2), 179-184 (2015-05-09)
Ubiquitin-proteasome system (UPS) proteins and proteolytic activity are localized in a recently identified cytoplasmic structure characterized by accumulation of barrel-like particles, which is known as the particulate cytoplasmic structure (PaCS). PaCSs have been detected in neoplastic, preneoplastic, chronically infected, and
Sujatha Muralidharan et al.
Journal of immunology (Baltimore, Md. : 1950), 193(4), 1975-1987 (2014-07-16)
Binge or moderate alcohol exposure impairs host defense and increases susceptibility to infection because of compromised innate immune responses. However, there is a lack of consensus on the molecular mechanism by which alcohol mediates this immunosuppression. In this study, we

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.