콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU072971

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK8

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AAGCTAAGCCGACCATTTCAGAATCAGACTCATGCCAAGCGGGCCTACAGAGAGCTAGTTCTTATGAAATGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGCTAGATCATGAAAGAATGTCCTACCTTCTCTATCAGATGCTGTGTGGAATCAAGCACCTTCATTCTGCTGGAATTATTCATCGGGACTTAAAGCCCAGTAATATAGTAGTAAAATCTGATTGCACTTTGAAGATTCTTGACTTCGGTCTGGCCAGGACTGCAGGAACGAGTTTTATGATGACGCCTTATGTAGTGACTCGCTACTACAGAGCACCCGAGGTCATCCTTGGCATGGGCTACAAGGAAAAC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wen-Pin Cheng et al.
Journal of the Formosan Medical Association = Taiwan yi zhi, 116(5), 388-397 (2016-09-21)
TRB3 (tribbles 3), an apoptosis-regulated gene, increases during endoplasmic reticulum stress. Hypoxia can induce inflammatory mediators and apoptosis in cardiomyocytes. However, the expression of TRB3 in cardiomyocyte apoptosis under hypoxia is not thoroughly known. We investigated the regulation mechanism of
Lan Xu et al.
Journal of molecular endocrinology (2019-03-27)
Obesity is a worldwide health problem with rising incidence and results in reproductive difficulties. Elevated saturated free fatty acids (FFAs) in obesity can cause insulin resistance (IR) in peripheral tissues. The high intra-follicular saturated FFAs may also account for IR
Lei Zhou et al.
Oncotarget, 8(55), 94009-94019 (2017-12-08)
Isoflurane can provide both neuroprotection and neurotoxicity in various culture models and in rodent developing brains. Emulsified Isoflurane (EI) is an emulsion formulation of isoflurane, while its underlying molecular mechanism of developemental nerve toxicity largely remains unclear. We hypothesized that
Mei-Chuan Chen et al.
Scientific reports, 7, 46149-46149 (2017-04-08)
Patients with ovarian cancer are typically diagnosed at an advanced stage, resulting in poor prognosis since there are currently no effective early-detection screening tests for women at average-risk for ovarian cancer. Here, we investigated the effects of MT-6, a derivative
Xu Qin et al.
Molecular carcinogenesis, 53(7), 526-536 (2013-01-30)
The c-Jun NH2 -terminal kinase (JNK) signal pathway has been implicated in the growth, cellular proliferation, and apoptosis in many kinds of carcinomas. However, the role of JNK in the development of esophageal squamous cell carcinomas (ESCCs) is unknown. To

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.