콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU072181

Sigma-Aldrich

MISSION® esiRNA

targeting human PITX2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

TTCAAAGGGATGTCCTCAGTGTCTGACATCTTTCACTACAAGTATTTCTAACAGTTGCAAGGACACATACACAAACAAATGTTTGACTGGATATGACATTTTAACATTACTATAAGCTTGTTATTTTTTAAGTTTAGCATTGTTAACATTTAAATGACTGAAAGGATGTATATATATCGAAATGTCAAATTAATTTTATAAAAGCAGTTGTTAGTAATATCACAACAGTGTTTTTAAAGGTTAGGCTTTAAAATAAAGCATGTTATACAGAAGCGATTAGGATTTTTCGCTTGCGAGCAAGGGAGTGTATATACTAAATGCCACACTGTATGTTTCTAACATATTATTATTATTATAAAAAATGTGTGAATATCAGTTTTAGAATAGTTTCTCTGGTGGATGCAATGATG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Wing-Kee Lee et al.
Cancer letters, 449, 237-251 (2019-02-12)
Oncogenic pituitary homeobox 2 (PITX2), a de facto master regulator of developmental organ asymmetry, previously upregulated multidrug resistance (MDR) P-glycoprotein ABCB1 in A498 renal cell carcinoma (RCC) cells. The role of PITX2 isoforms in MDR cancers was investigated. Data mining
Yu-Hsun Kao et al.
European journal of clinical investigation, 49(10), e13160-e13160 (2019-08-06)
A Pitx2c deficiency increases the risk of atrial fibrillation (AF). Atrial structural remodelling with fibrosis blocks electrical conduction and leads to arrhythmogenesis. A Pitx2c deficiency enhances profibrotic transforming growth factor (TGF)-β expression and calcium dysregulation, suggesting that Pitx2c may play
Estefanía Lozano-Velasco et al.
Cardiovascular research, 109(1), 55-66 (2015-08-06)
Atrial fibrillation (AF) is the most common type of arrhythmia in humans, yet the genetic cause of AF remains elusive. Genome-wide association studies (GWASs) have reported risk variants in four distinct genetic loci, and more recently, a meta-GWAS has further
Estefanía Lozano-Velasco et al.
Molecular and cellular biology, 35(17), 2892-2909 (2015-06-10)
The acquisition of a proliferating-cell status from a quiescent state as well as the shift between proliferation and differentiation are key developmental steps in skeletal-muscle stem cells (satellite cells) to provide proper muscle regeneration. However, how satellite cell proliferation is
Ryuta Tanimoto et al.
Endocrinology, 156(1), 58-70 (2014-11-05)
The growth factor progranulin is as an important regulator of transformation in several cellular systems. We have previously demonstrated that progranulin acts as an autocrine growth factor and stimulates motility, proliferation, and anchorage-independent growth of castration-resistant prostate cancer cells, supporting

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.