추천 제품
설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
ACCCCTCTCCTCTGTCTCCAGAAGCTTCTAGCTCTGGGGTCTGGCTACCGCTAGGAGGCTGAGCAAGCCAGGAAGGGAAGGAGTCTGTGTGGTGTGTATGTGCATGCAGCCTACACCCACACGTGTGTACCGGGGGTGAATGTGTGTGAGCATGTGTGTGTGCATGTACCGGGGAATGAAGGTGAACATACACCTCTGTGTGTGCACTGCAGACACGCCCCAGTGTGTCCACATGTGTGTGCATGAGTCCATGTGTGCGCGTGGGGGGGCTCTAACTGCACTTTCGGCCCTTTTGCTCTGGGGGTCCCACAAGGCCCAGGGCAGTGCCTGCTCCCAGAATCTGGTGCTCTGACCAGGCCAGGTGGGGAGGCTTTGGCTGGCTGGGCGTGTAGGACGGTGAGAGCACTTCT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... E2F1(1869) , E2F1(1869)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Yuan He et al.
Life sciences, 252, 117656-117656 (2020-04-15)
Diabetes is considered as one of the important risks in the progression of Hepatocellular carcinoma(HCC). Ribosome binding protein 1 (RRBP1), a rough endoplasmic reticulum protein, plays an essential role in diabetes and various cancer. E2F transcription factor 1 (E2F1), an
Lei Liu et al.
Oncology reports, 37(6), 3597-3605 (2017-05-13)
Tripartite motif containing 28 (TRIM28) is a universal corepressor for Kruppel‑associated box zinc finger proteins. In our previous study, it was shown that expression of TRIM28 is upregulated in non‑small cell lung cancer (NSCLC) cell lines and tissues. Here, we
Wen Luo et al.
Scientific reports, 6, 27904-27904 (2016-06-11)
miR-17 family microRNAs (miRNAs) are crucial for embryo development, however, their role in muscle development is still unclear. miR-20a-5p and miR-20b-5p belong to the miR-17 family and are transcribed from the miR-17~92 and miR-106a~363 clusters respectively. In this study, we
Juan Liu et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(2), 2673-2682 (2015-09-26)
Cancerous inhibitor of protein phosphatase 2A (CIP2A) is a recently identified oncoprotein. Here, we investigated its role in the formation of multidrug resistance (MDR) of cervical adenocarcinoma in vitro and in vivo. MTT assay showed that knockdown of CIP2A expression
Dan Zhao et al.
Frontiers in molecular neuroscience, 12, 281-281 (2019-12-24)
Intracerebral hemorrhage (ICH) is a subtype of stroke with highest mortality and morbidity. We have previously demonstrated that dipotassium bisperoxo (picolinato) oxovanadate (V), (bpV[pic]) inhibits phosphatase and tensin homolog (PTEN) and activates extracellular signal-regulated kinase (ERK)1/2. In this study, we
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU070981-50UG | 4061828370979 |
| EHU070981-20UG | 4061831352467 |
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.