콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU070611

Sigma-Aldrich

MISSION® esiRNA

targeting human RBBP8

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACCCCCATGTCCGATACATAGAACAAACACATACTAAATTGGAGCACTCTGTGTGTGCAAATGAAATGAGAAAAGTTTCCAAGTCTTCAACTCATCCACAACATAATCCTAATGAAAATGAAATTCTAGTAGCTGACACTTATGACCAAAGTCAATCTCCAATGGCCAAAGCACATGGAACAAGCAGCTATACCCCTGATAAGTCATCTTTTAATTTAGCTACAGTTGTTGCTGAAACACTTGGACTTGGTGTTCAAGAAGAATCTGAAACTCAAGGTCCCATGAGCCCCCTTGGTGATGAGCTCTACCACTGTCTGGAAGGAAATCACAAGAAACAGCCTTTTGAGGAATCTACAAGAAATACTGAAGATAGTTTAAGATTTTCAGATTCTACTTCAAAGACTCCTCCTCAAGAAGAATTACCTACTCGAGTGTCATCTCCTGTATTTGGAGC

Ensembl | 인체 수납 번호

ENSG00000101773

NCBI 수납 번호

NM_203292

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... RBBP8(5932) , RBBP8(5932)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
VDV
ACIU
WXU
WIU
BJT

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Isabel Soria-Bretones et al.
Nature communications, 8(1), 113-113 (2017-07-26)
DNA breaks are complex DNA lesions that can be repaired by two alternative mechanisms: non-homologous end-joining and homologous recombination. The decision between them depends on the activation of the DNA resection machinery, which blocks non-homologous end-joining and stimulates recombination. On
Oriane Bombarde et al.
Molecular cancer therapeutics, 16(10), 2166-2177 (2017-06-15)
Poisons of topoisomerase II (TOP2) kill cancer cells by preventing religation of intermediate DNA breaks during the enzymatic process and thus by accumulating enzyme-drug-DNA complexes called TOP2 cleavage-complex (TOP2cc). F14512 is a highly cytotoxic polyamine-vectorized TOP2 inhibitor derived from etoposide
Li Du et al.
Cancer research, 80(19), 4212-4223 (2020-08-21)
Elevated expression of EZH2, the enzymatic subunit of polycomb repressive complex 2 (PRC2), often occurs in cancer. EZH2 expression results in the silencing of genes that suppress tumor formation and metastasis through trimethylation of histone H3 at lysine 27 (H3K27me3)
Jianfeng Shen et al.
Cancer research, 79(2), 311-319 (2018-11-30)
PARP inhibitors (PARPi) have shown remarkable therapeutic efficacy against BRCA1/2-mutant cancers through a synthetic lethal interaction. PARPi exert their therapeutic effects mainly through the blockade of ssDNA damage repair, which leads to the accumulation of toxic DNA double-strand breaks specifically
Xingyue He et al.
PloS one, 10(4), e0123882-e0123882 (2015-04-11)
SUMOylation is a post-translational ubiquitin-like protein modification pathway that regulates important cellular processes including chromosome structure, kinetochore function, chromosome segregation, nuclear and sub-nuclear organization, transcription and DNA damage repair. There is increasing evidence that the SUMO pathway is dysregulated in
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.