설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CCACAAGAGCTGAGGGTTTCATAACTTTATGGCTTAATAAATGTATGACACTGAAAAGATTTGAGTGTGAATCTACTGAAATCACTATAATGCACATTGAAGCTATGATGGTATTTGAGTAGTGAGGTTACTTTTGATCGGAGCAACATAATGCTCATAGAATCTTCTAGAAGAAGAGAAACAAAGGGATTGATAAAATGCTGAGAACTAGTGATTATATATTTTTCTGTATTTACCTGACATTTATTTTAATGTTCAAAAAGTAAACACTTTAAGTTTGATGTGTTTTACTCTCTCATTGTTTTAAGTAATTGCCAACTCAGAATACATCATTCTTAGGCTGAAATTTGTCTTTCCATTTTTTAAGGTGAAATAGTACTACCTTACGTGATAGCATACAAAGAAGAAAGC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... LMO3(55885) , LMO3(55885)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
International journal of molecular medicine, 41(5), 2755-2763 (2018-02-14)
The present study assessed the biological functions of LIM domain only 3 (LMO3) in gastric cancer (GC) investigated and the underlying molecular mechanisms. It was revealed that the expression of LMO3 was significantly upregulated in GC tissues. A GC tissue microarray
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.