콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU069741

Sigma-Aldrich

MISSION® esiRNA

targeting human POSTN

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AATCATCCATGGGAACCAGATTGCAACAAATGGTGTTGTCCATGTCATTGACCGTGTGCTTACACAAATTGGTACCTCAATTCAAGACTTCATTGAAGCAGAAGATGACCTTTCATCTTTTAGAGCAGCTGCCATCACATCGGACATATTGGAGGCCCTTGGAAGAGACGGTCACTTCACACTCTTTGCTCCCACCAATGAGGCTTTTGAGAAACTTCCACGAGGTGTCCTAGAAAGGATCATGGGAGACAAAGTGGCTTCCGAAGCTCTTATGAAGTACCACATCTTAAATACTCTCCAGTGTTCTGAGTCTATTATGGGAGGAGCAGTCTTTGAGACGCTGGAAGGAAATACAATTGAGATAGGATGTGACGGTGACAGTATAACAGTAAATGGAATCAAAATGGTGAACAAAAAGGATATTGTGACAAATAATGGTGTGATCCATTTGATTGA

Ensembl | 인체 수납 번호

ENSG00000133110

NCBI 수납 번호

NM_006475

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... POSTN(10631) , POSTN(10631)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

A Tomaru et al.
Gene therapy, 24(11), 706-716 (2017-08-19)
Idiopathic pulmonary fibrosis (IPF) is a fatal disease with a median survival of 3-4 years after diagnosis. It is the most frequent form of a group of interstitial pneumonias of unknown etiology. Current available therapies prevent deterioration of lung function
Yujin Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 88, 342-348 (2017-01-26)
Hypoxia has been suggested to induce chemoresistance in tumor cells. In this study, we aimed to test the hypothesis that hypoxia-inducible factor-1alpha (HIF-1α)/periostin axis might promote arsenic trioxide resistance in hepatocellular carcinoma (HCC) cells under hypoxia. HCC cells were exposed
Jae Eun Um et al.
Scientific reports, 7(1), 8490-8490 (2017-08-19)
Diabetic nephropathy, the major cause of chronic kidney disease, is associated with progressive renal fibrosis. Recently, accumulation of periostin, an extracellular matrix protein, was shown to augment renal fibrosis. Aptamers have higher binding affinities without developing the common side effects
Xiting Han et al.
Journal of cellular physiology, 234(8), 14170-14180 (2019-01-12)
The human cervical cancer (CC) has been identified as one of the most common tumors in women, and the molecular regulation in CC still remains unclear. The dysregulation of periostin has been found in a variety of cancers, but whether
Xiaofan Guo et al.
Oncotarget, 7(49), 80521-80542 (2016-09-08)
Tumor-associated macrophages (TAMs) are enriched in gliomas and help create a tumor-immunosuppressive microenvironment. A distinct M2-skewed type of macrophages makes up the majority of glioma TAMs, and these cells exhibit pro-tumor functions. Gliomas contain large hypoxic areas, and the presence
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.