콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU068851

Sigma-Aldrich

MISSION® esiRNA

targeting human ASAP1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTTGAGGCCATCAAATCCAGGGATTTACTTGCACTAATTCAAGTCTATGCAGAAGGGGTAGAGCTAATGGAACCACTGCTGGAACCTGGGCAGGAGCTTGGGGAGACAGCCCTTCACCTTGCCGTCCGAACTGCAGATCAGACATCTCTCCATTTGGTTGACTTCCTTGTACAAAACTGTGGGAACCTGGATAAGCAGACGGCCCTGGGAAACACAGTTCTACACTACTGTAGTATGTACAGTAAACCTGAGTGTTTGAAGCTTTTGCTCAGGAGCAAGCCCACTGTGGATATAGTTAACCAGGCTGGAGAAACTGCCCTAGACATAGCAAAGAGACTAAAAGCTACCCAGTGTGAAGATCTGCTTTCCCAGGCTAAATCTGGAAAGTTCAATCCACACGTCCACGTAGAAT

Ensembl | 인체 수납 번호

ENSG00000153317

NCBI 수납 번호

NM_018482

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ASAP1(50807) , ASAP1(50807)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jia Cui et al.
Frontiers in cellular and infection microbiology, 10, 519503-519503 (2020-11-17)
The ADP ribosylation factor (ARF) GTPase activation protein ASAP1 possesses multiple biological functions, including regulation of cytoskeletal dynamics, small GTP-binding protein receptor recycling, and intracellular vesicle trafficking. Recently, ASAP1 polymorphisms have been reported to be associated with human susceptibility to
Anjelika Gasilina et al.
iScience, 22, 166-180 (2019-12-01)
ASAP1 is a multi-domain ArfGAP that controls cell migration, spreading, and focal adhesion dynamics. Although its GAP activity contributes to remodeling of the actin cytoskeleton, it does not fully explain all cellular functions of ASAP1. Here we find that ASAP1
Sheroy Minocherhomji et al.
Nature, 528(7581), 286-290 (2015-12-04)
Oncogene-induced DNA replication stress has been implicated as a driver of tumorigenesis. Many chromosomal rearrangements characteristic of human cancers originate from specific regions of the genome called common fragile sites (CFSs). CFSs are difficult-to-replicate loci that manifest as gaps or

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.