콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU068241

Sigma-Aldrich

MISSION® esiRNA

targeting human P2RX4

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ATACACGGGACGTTGAGCACAACGTATCTCCTGGCTACAATTTCAGGTTTGCCAAGTACTACAGAGACCTGGCTGGCAACGAGCAGCGCACGCTCATCAAGGCCTATGGCATCCGCTTCGACATCATTGTGTTTGGGAAGGCAGGGAAATTTGACATCATCCCCACTATGATCAACATCGGCTCTGGCCTGGCACTGCTAGGCATGGCGACCGTGCTGTGTGACATCATAGTCCTCTACTGCATGAAGAAAAGACTCTACTATCGGGAGAAGAAATATAAATATGTGGAAGATTACGAGCAGGGTCTTGCTAGTGAGCTGGACCAGTGAGGCCTACCCCACACCTGGGCTCTCCACAGCCCCATCAAAGAACAGAGAGGAGGAGGAGGGAGAAATGGCCACCACATCACCCCAGAGAAATTTCTGGAATCTGATTGAGTCTCCACTCCACAAGCACTCA

Ensembl | 인체 수납 번호

ENSG00000135124

NCBI 수납 번호

NM_002560

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... P2RX4(5025) , P2RX4(5025)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

죄송합니다. 지금은 이 제품에 대한 COA이(가) 온라인에서 제공되지 않습니다.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jun-Feng Huo et al.
Journal of cellular biochemistry, 120(4), 6322-6329 (2018-10-27)
Purinergic receptor P2X 4 (P2X4R), a member of purinergic channels family and a subtype of ionotropic adenosine triphosphate receptors, plays a critical role in tumorigenesis. Evidence suggested that P2X4R is expressed in rat C6 glioma model, however, its role and
Dmitry Aminin et al.
Scientific reports, 6, 39683-39683 (2016-12-23)
Since ancient times, edible sea cucumbers have been considered a jewel of the seabed and used in Asian folk medicine for stimulation of resistance against different diseases. However, the power of this sea food has not been established on a
Larisa Gofman et al.
Alcohol and alcoholism (Oxford, Oxfordshire), 51(6), 647-654 (2016-10-30)
Previously we have demonstrated altered microglia P2X4R expression in response to alcohol and pharmacological blockade with a selective P2X4R antagonist can reverse the action, suggesting that P2X4R play a role in mediating alcohol-induced effects on microglia. In the present study
Xiao-Hong Jin et al.
Journal of neuroscience research, 92(12), 1690-1702 (2014-07-06)
Previous studies have suggested that the microglial P2X7 purinoceptor is involved in the release of tumor necrosis factor-α (TNFα) following activation of toll-like receptor-4 (TLR4), which is associated with nociceptive behavior. In addition, this progress is evoked by the activation

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.