콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU067311

Sigma-Aldrich

MISSION® esiRNA

targeting human NFKB2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

AGCAAGAGGCCAAAGAACTGAAGAAGGTGATGGATCTGAGTATAGTGCGGCTGCGCTTCTCTGCCTTCCTTAGAGCCAGTGATGGCTCCTTCTCCCTGCCCCTGAAGCCAGTCATCTCCCAGCCCATCCATGACAGCAAATCTCCGGGGGCATCAAACCTGAAGATTTCTCGAATGGACAAGACAGCAGGCTCTGTGCGGGGTGGAGATGAAGTTTATCTGCTTTGTGACAAGGTGCAGAAAGATGACATTGAGGTTCGGTTCTATGAGGATGATGAGAATGGATGGCAGGCCTTTGGGGACTTCTCTCCCACAGATGTGCATAAACAGTATGCCATTGTGTTCCGGACACCCCCCTATCACAAGATGAAGATTGAGCGGCCTGTAACAGTGTTTCTGCAACTGAAACGCAAG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jeong Seon Kim et al.
Biochemical and biophysical research communications, 491(2), 337-342 (2017-07-25)
The NFκB family of transcription factors is crucial for innate or adaptive immunity, inflammation, and diseases including cancer. The two NFκB signaling pathways (canonical and non-canonical) differ from each other in extracellular signals, membrane receptors, signaling adaptors, and dimer subunits.
Shayna E Thomas-Jardin et al.
The Prostate, 80(2), 133-145 (2019-11-16)
The androgen receptor (AR) nuclear transcription factor is a therapeutic target for prostate cancer (PCa). Unfortunately, patients can develop resistance to AR-targeted therapies and progress to lethal disease, underscoring the importance of understanding the molecular mechanisms that underlie treatment resistance.
Laura Mondragón et al.
Cancer cell, 36(3), 268-287 (2019-08-27)
GAPDH is emerging as a key player in T cell development and function. To investigate the role of GAPDH in T cells, we generated a transgenic mouse model overexpressing GAPDH in the T cell lineage. Aged mice developed a peripheral Tfh-like lymphoma that

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.