콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU066241

Sigma-Aldrich

MISSION® esiRNA

targeting human NDRG2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGGGAAAAAGGGCAGATCATGCGGGGAGATGACCTTGATCTTTGATTGCTACCCTAACCTTGACCTTTAACCCGTGATTCCCCCCAGCTCCTGGAAGAGATGTCCTAATATCTCTTAGGGACCCAGACCCCTAAATTCTCCTCCTCCCCCATTTTGATGTTAAGGTGGAGAGGGCATATGCATCCTCTGTCCTGATCTAGGTGTCTATAGCTGAGGGGTAAGAGGTTGTTGTAGTTGTCCTGGTGCCTCCATCAGACTCTCCCTACTTGTCCCATATTTGCAAGGGGAGGGGATTTGGGGCTGGGGCTCCATTCACCAAAGCTGAGGTGGCTTCTCATTAACCCTTTAGGACTCTGAAGGGTATGGACCTACGTGAATGTGTGTCAGGGGGAGACTTGCTGGTGGGTTAGTGGT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Z H Su et al.
Neoplasma, 67(5), 1002-1011 (2020-05-27)
Renal cell carcinoma (RCC) is the most common malignant tumor of the kidney. In this study, we investigated the role of miR-346 in RCC cells under hypoxia. OS-RC-2 and 786-O cells were cultured in 1% O2 or normal oxygen. Cell
Kyeongah Kang et al.
Biochemical and biophysical research communications, 468(4), 611-616 (2015-11-08)
N-Myc downstream-regulated gene 2 (NDRG2), a member of the NDRG family of differentiation-related genes, has been characterized as a regulator of dendritic cell differentiation from monocytes, CD34(+) progenitor cells, and myelomonocytic leukemic cells. In this study, we show that NDRG2
Fenhong Kang et al.
Journal of ovarian research, 13(1), 48-48 (2020-04-30)
The cancer cell metastasis and the acquisition of chemotherapy resistance remain huge challenge for ovarian cancer treatment. Previously, N-myc downstream-regulated gene 2 (NDRG2) serves as a tumor suppressor for many cancers. Here, we attempted to investigate the specific roles of
Qiang Fu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 97, 120-127 (2017-10-29)
MicroRNA-454 (miR-454) is emerging as critical regulator in tumorigenesis; it may function as an oncogene or a tumor suppressor. However, the role of miR-454 in prostate cancer remains unknown. In this study, we aimed to investigate the function and molecular
Xinyu Deng et al.
Oncotarget, 8(24), 38294-38308 (2017-04-19)
Breast cancer (BC) is a leading cause of cancer-related death in women. Adjuvant systemic chemotherapies are effective in reducing risks of recurrence and have contributed to reduced BC mortality. Although targeted adjuvant treatments determined by biomarkers for endocrine and HER2-directed

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.