설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GTTCATGGAGCCTGGAGCTACAACCGGGTGACCAAGTGCATCTTGTACTGCTTCTATAAGAACGTGGTCCTGTATATTATTGAGCTTTGGTTCGCCTTTGTTAATGGATTTTCTGGGCAGATTTTATTTGAACGTTGGTGCATCGGCCTGTACAATGTGATTTTCACCGCTTTGCCGCCCTTCACTCTGGGAATCTTTGAGAGGTCTTGCACTCAGGAGAGCATGCTCAGGTTTCCCCAGCTCTACAAAATCACCCAGAATGGCGAAGGCTTCAACACAAAGGTTTTCTGGGGTCACTGCATCAACGCCTTGGTCCACTCCCTCATCCTCTTCTGGTTTCCCATGAAAGCTCTGGAGCATGATACTGTGTTGACAAGTGGTCATGCTACCGACTATTTATTTGTTGGAAATATTGTTTACACATATGTTGTTGTTACTGTTTGTCTGAAAGCTGGTTTGGAGACC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... ATP8A2(51761) , ATP8A2(51761)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
A Dorronsoro et al.
Cell death & disease, 4, e972-e972 (2013-12-21)
The zinc-finger protein A20 is a key player in the negative feedback regulation of the nuclear factor kappa-light-chain-enhancer of activated B-cell (NF-κB) pathway in response to multiple stimuli. Tumor necrosis factor alpha (TNFα), a cytokine with pleiotropic effects on cellular
Kerstin Boengler et al.
Basic research in cardiology, 105(6), 771-785 (2010-10-21)
The signal transducer and activator of transcription 3 (STAT3) contributes to cardioprotection by ischemic pre- and postconditioning. Mitochondria are central elements of cardioprotective signaling, most likely by delaying mitochondrial permeability transition pore (MPTP) opening, and STAT3 has recently been identified
Antonio Pisano et al.
The Journal of biological chemistry, 290(22), 13958-13971 (2015-04-18)
The human inhibitor of Bruton's tyrosine kinase isoform α (IBtkα) is a BTB protein encoded by the IBTK gene, which maps to chromosomal locus 6q14.1, a mutational hot spot in lymphoproliferative disorders. Here, we demonstrate that IBtkα forms a CRL3(IBTK)
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.