콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU065551

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP11C

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CAGAAAGAGCGAGAGACCTTGAAGGTTTTAAAAATGTTCACCGACTTCCTATCATTTATGGTTCTATTCAACTTTATCATTCCTGTCTCCATGTACGTCACAGTAGAAATGCAGAAATTCTTGGGCTCCTTCTTCATCTCATGGGATAAGGACTTTTATGATGAAGAAATTAATGAAGGAGCCCTGGTTAACACATCAGACCTTAATGAAGAACTTGGTCAGGTGGATTATGTATTTACAGATAAGACTGGAACACTCACTGAAAACAGCATGGAATTCATTGAATGCTGCATAGATGGCCACAAATATAAAGGTGTAACTCAAGAGGTTGATGGATTATCTCAAACTGATGGAACTTTAACATATTTTGACAAAGTAGATAAGAATCGAGAAGAGCTGTTTCTACGTGCCTTGTGTTTATGTCATACTGTAGAAATCAAAACAAACGATGCTGTTGATGGAGCTA

Ensembl | 인체 수납 번호

ENSG00000101974

NCBI 수납 번호

NM_001010986

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... ATP11C(286410) , ATP11C(286410)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Alessandra Ghiani et al.
PloS one, 11(5), e0155803-e0155803 (2016-05-18)
Tomato (Solanum lycopersicum) is one of the most extensively consumed vegetables but, unfortunately, it is also able to induce allergic reactions. In the past, it has been shown that the choice of tomato cultivar significantly influenced the allergic reaction of
Theo Rispens et al.
PloS one, 8(2), e55566-e55566 (2013-02-08)
IgE antibodies to gal-α-1,3-gal-β-1,4-GlcNAc (α-gal) can mediate a novel form of delayed anaphylaxis to red meat. Although IgG antibodies to α-gal (anti-α-gal or anti-Gal) are widely expressed in humans, IgE anti-α-gal is not. We explored the relationship between the IgG
Donatien Kamdem Toukam et al.
PloS one, 7(5), e38068-e38068 (2012-06-06)
Although human immunodeficiency type 1 (HIV-1) infection induces strong antibody responses to the viral envelope glycoprotein (Env) only a few of these antibodies possess the capacity to neutralize a broad range of strains. The induction of such antibodies represents an
Yan-Da Lai et al.
International journal of molecular sciences, 17(2), 214-214 (2016-02-11)
Vascular endothelial growth factor (VEGF) is an important stimulator for angiogenesis in solid tumors. Blocking VEGF activity is an effective therapeutic strategy to inhibit tumor growth and metastasis. Avastin, a humanized monoclonal antibody recognizes VEGF, has been approved by the
Simone Mader et al.
Journal of neuroinflammation, 8, 184-184 (2011-12-30)
Serum autoantibodies against the water channel aquaporin-4 (AQP4) are important diagnostic biomarkers and pathogenic factors for neuromyelitis optica (NMO). However, AQP4-IgG are absent in 5-40% of all NMO patients and the target of the autoimmune response in these patients is
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.