콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU064361

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX4

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TTCCTCATGATCACAGCCTCTACATATGCAATAAGAGTTTCTAACTATGATATCTTCTGGTATACTCATAACCTCTTCTTTGTCTTCTACATGCTGCTGACGTTGCATGTTTCAGGAGGGCTGCTGAAGTATCAAACTAATTTAGATACCCACCCTCCCGGCTGCATCAGTCTTAACCGAACCAGCTCTCAGAATATTTCCTTACCAGAGTATTTCTCAGAACATTTTCATGAACCTTTCCCTGAAGGATTTTCAAAACCGGCAGAGTTTACCCAGCACAAATTTGTGAAGATTTGTATGGAAGAGCCCAGATTCCAAGCTAATTTTCCACAGACTTGGCTTTGGATTTCTGGACCTTTGTGCCTGTACTGTGCCGAAAGACTTTACAGGTATATCCGGAGCAATAAGCCAGTCACCATCATTTCGGTCATGAGTCATCCCTCAGATGTCATGGAAATCCGAATGGTCAA

Ensembl | 인체 수납 번호

ENSG00000086991

NCBI 수납 번호

NM_016931

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... NOX4(50507) , NOX4(50507)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Junwei Zhang et al.
European journal of pharmacology, 804, 1-6 (2017-04-12)
Naringin, a naturally flavanone glycoside, has been previously demonstrated to alleviate diabetic kidney disease by inhibiting oxidative stress and inflammatory reaction. However, the underlying mechanism of naringin in diabetic nephropathy (DN) has not been fully elucidated. Here, the beneficial effect
Qipeng Wu et al.
Experimental cell research, 352(2), 245-254 (2017-02-16)
The redox adaptation mechanisms in cancer cells are very complex and remain largely unclear. Our previous studies have confirmed that NADPH oxidase 4 (NOX4) is abundantly expressed in non-small cell lung cancer (NSCLC) and confers apoptosis resistance on NSCLC cells.
Weichao Guo et al.
American journal of physiology. Lung cellular and molecular physiology, 312(6), L936-L944 (2017-03-25)
Myofibroblasts are important mediators of fibrogenesis; thus blocking fibroblast-to-myofibroblast differentiation (FMD) may be an effective strategy to treat pulmonary fibrosis (PF). Previously, we reported that histone deacetylase 4 (HDAC4) activity is necessary for transforming growth factor-β
Wenwen Zhao et al.
Scientific reports, 7(1), 12953-12953 (2017-10-13)
ICAM-1 overexpression and subsequent adhesion of leukocytes to endothelial cells play critical roles in the early stage of atherosclerosis. Danshenol A (DA) is an abietane-type diterpenoid isolated from traditional Chinese herb Salvia miltiorrhiza Bunge. The mechanisms under its regulation of
Ha-Reum Lee et al.
Arthritis research & therapy, 22(1), 116-116 (2020-05-18)
Reactive oxygen species (ROS) regulate the migration and invasion of fibroblast-like synoviocytes (FLS), which are key effector cells in rheumatoid arthritis (RA) pathogenesis. Nicotinamide adenine dinucleotide phosphate oxidase 4 (NOX4) induces ROS generation and, consequently, enhances cell migration. Despite the
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.