콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU063971

Sigma-Aldrich

MISSION® esiRNA

targeting human CALCR

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GGCCTGCAACTATTTCTGGATGCTCTGTGAAGGGATCTATCTTCATACACTCATTGTCGTGGCTGTGTTTACTGAGAAGCAACGCTTGCGGTGGTATTATCTCTTGGGCTGGGGGTTCCCGCTGGTGCCAACCACTATCCATGCTATTACCAGGGCCGTGTACTTCAATGACAACTGCTGGCTGAGTGTGGAAACCCATTTGCTTTACATAATCCATGGACCTGTCATGGCGGCACTTGTGGTCAATTTCTTCTTTTTGCTCAACATTGTCCGGGTGCTTGTGACCAAAATGAGGGAAACCCATGAGGCGGAATCCCACATGTACCTGAAGGCTGTGAAGGCCACCATGATCCTTGTGCCCCTGCTGGGAATCCAGTTTGTCGTCTTTCCCTGGAGACCTTCCAACAAGATGCTTGGGAAGATATATGATTACGTGATGCACTCTCTGATTCATTTCCAGGGCTTCTTTG

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Barbara Toffoli et al.
Clinical science (London, England : 1979), 134(17), 2337-2352 (2020-08-29)
TNF-related apoptosis-inducing ligand (TRAIL) has attracted attention not only as an anti-cancer agent, but also as a potential treatment for diabetes. Animal studies have shown that TRAIL delivery ameliorated glucose control in type 1 and type 2 diabetes. It is
Ruo Feng et al.
Diagnostic pathology, 10, 149-149 (2015-08-27)
Hepatocellular carcinoma (HCC) is one of the most frequent cancers in the world. Calreticulin(CRT) is aberrantly overexpressed in many human cancer cells. The function of CRT in HCC cells remains unclear. We attempted to investigate the effects and the underlying
Saurabh Vig et al.
Cell cycle (Georgetown, Tex.), 14(14), 2274-2284 (2015-05-07)
Calreticulin (CRT) is an endoplasmic reticulum (ER) resident calcium binding protein that is involved in several cellular activities. Transcriptome analyses in CRT knockdown HepG2 cells revealed 253 altered unique genes and subsequent in silico protein-protein interaction network and MCODE clustering
Beatrice Rondinelli et al.
Nucleic acids research, 43(5), 2560-2574 (2015-02-26)
DNA replication is a tightly regulated process that initiates from multiple replication origins and leads to the faithful transmission of the genetic material. For proper DNA replication, the chromatin surrounding origins needs to be remodeled. However, remarkably little is known
Xuemin Wang et al.
PloS one, 10(4), e0125402-e0125402 (2015-05-01)
Cisplatin is one of the first-line platinum-based chemotherapeutic agents for treatment of many types of cancer, including ovary cancer. CTR1 (copper transporter 1), a transmembrane solute carrier transporter, has previously been shown to increase the cellular uptake and sensitivity of

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.