설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
ACTTTGAGAGCTGCCTTGGAGCCAAGCAAGGATTTAAAGGATTCCAAGTTGCTCCTGAACATCATAATGACCATAAGACCTTTATCTATGATAACACTGAATTCACCCTTGCTCATGGTTCTGTGGTCATTGCTGCCATTACTAGCTGCACAAACACCAGTAATCCGTCTGTGATGTTAGGGGCAGGATTGTTAGCAAAGAAAGCTGTGGATGCTGGCCTGAACGTGATGCCTTACATCAAAACTAGCCTGTCTCCTGGGAGTGGCGTGGTCACCTACTACCTACAAGAAAGCGGAGTCATGCCTTATCTGTCTCAGCTTGGGTTTGACGTGGTGGGCTATGGCTGCATGACCTGCATTGGCAACAGTGGGCCTTTACCTGAACCTGTGGTAGAAGCCATCACACAGGGAGACCTT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2301-2311 (2020-01-08)
Iron is an essential element to all living organisms and plays a vital role in many cellular processes, such as DNA synthesis and energy production. The Mdm2 oncogene is an E3 ligase and known to promote tumor growth. However, the
PloS one, 8(3), e58845-e58845 (2013-03-23)
Mammalian cells require iron to satisfy metabolic needs or to accomplish specialized functions, and DNA viruses, like bovine herpesvirus 1 (BHV-1), require an iron-replete host to efficiently replicate, so that iron bioavailability is an important component of viral virulence. Cellular
Carcinogenesis, 41(8), 1113-1122 (2019-11-18)
Precursor T-cell lymphoblastic neoplasms are aggressive malignancies in need for more effective and specific therapeutic treatments. A significant fraction of these neoplasms harbor deletions on the locus 9p21, targeting the tumor suppressor CDKN2A but also deleting the aconitase 1 (ACO1)
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.