콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU062671

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX10, MIR6820

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

CTGAAGGCAGGAAGGAGTTGGCACAGAGGCCCCCTGATCCAATTCTGTGCCAATAACCTCATTCTTTGTCTGAGAAACAGCCCCCAGTCCTCCTCCACTACAACCTCCATGACCTTGAGACGCATCCCAGGAGGTGACGAGGCAGGGGCTCCAGGAAAGGAATCAGAGACAATTCACAGAGCCTCCCTCCCTGGGCTCCTTGCCAGCTCCCTCTTCCCTTACTAGGCTCTATGGCCCCTGCTCAGTCAGCCCCACTCCCTGGGCTTCCCAGAGAGTGACAGCTGCTCAGGCCCTAACCCTTGGCTCCAGGAGACACAGGGCCCAGCACCCAGGTTGCTGTCGGCAGGCTGAAGACACTAGAATCCTGACCTGTACATTCTGCCCTTGCCTCTTACCCCTTGCCTCCCAGTGGTATTT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Carmen Bravo González-Blas et al.
Nature methods, 16(5), 397-400 (2019-04-10)
We present cisTopic, a probabilistic framework used to simultaneously discover coaccessible enhancers and stable cell states from sparse single-cell epigenomics data ( http://github.com/aertslab/cistopic ). Using a compendium of single-cell ATAC-seq datasets from differentiating hematopoietic cells, brain and transcription factor perturbations
Wen Feng et al.
Biochemical and biophysical research communications, 485(2), 522-528 (2017-02-13)
The mechanisms modulating the cancer stem cell (CSC) properties of triple negative breast cancer (TNBC) cells were not fully understood. In this study, we performed data mining in Breast Cancer Gene-Expression Miner v4.0 and found that TNBC tumors had significantly
Liesbeth Minnoye et al.
Genome research, 30(12), 1815-1834 (2020-08-01)
Deciphering the genomic regulatory code of enhancers is a key challenge in biology because this code underlies cellular identity. A better understanding of how enhancers work will improve the interpretation of noncoding genome variation and empower the generation of cell

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.