콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU060941

Sigma-Aldrich

MISSION® esiRNA

targeting human MXI1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

GCAGTGCAGTTGAGTTGTGTGTTAATGTTAGACTATCCCTTTGTGAGTGACACTTTAACAGCATTCACTGCTTCTATATATAGTGTACCATCTTGGTCATACATTACGCCTCAACATATACTTGTGCTCTTCCTTTGCCTCCAGAAGAAGTTTTTCCTTGATTGTGCTATGTTTCAGTGGAAGAAATTCTTTGAAGTAGATGTGAGTGAAAAACTGCATGCCTTTAGAAGCCCAGTATCAGAACTTGCTACGTTTCAGGTGCTAGGGACTTAATGAAAAACAGGACAAAACAATTCCTTTTTGTGGCCCAGGTAAATTATTTCTGGTTTCACTTATAATTACTAATGGCTGAGTCAAGATGTTGTCTCTGTGTTTGCTTACTCTTGATCAAGTGTGAGACAGTTTGAAGACTGTGCTACCATACAAAGTGAATGAAGCCAGTGACTAAGCTTCTGTTTGTTTTGTTATTCTCATGGCCTTCGCT

Ensembl | 인체 수납 번호

ENSG00000119950

NCBI 수납 번호

NM_001008541

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... MXI1(4601) , MXI1(4601)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number
QQT

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

COA 검색

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Jianwen Zhou et al.
PloS one, 8(12), e83055-e83055 (2014-01-01)
Gliomas are the most common and aggressive primary tumors in the central nervous system. Recently, Max interactor-1 (MXI1), an antagonist of c-Myc that is involved in brain tumor progression, has been reported to be deregulated in a variety of tumors
Stacie E Dodgson et al.
Genes & development, 30(20), 2259-2271 (2016-11-04)
Aneuploidy-or an unbalanced karyotype in which whole chromosomes are gained or lost-causes reduced fitness at both the cellular and organismal levels but is also a hallmark of human cancers. Aneuploidy causes a variety of cellular stresses, including genomic instability, proteotoxic
Xingkang Wu et al.
Biochemical and biophysical research communications, 499(4), 927-933 (2018-04-08)
Colorectal cancer (CRC) is the third most prevalent malignancy worldwide. New understandings about this disease are urgently required to guide clinical therapies. In this study, we focused on the effects of the small molecule PMN on CRC cells. PMN dose-dependently
Ana Vanessa Nascimento et al.
Acta biomaterialia, 47, 71-80 (2016-10-19)
Efficiency of chemotherapy is often limited by low therapeutic index of the drug as well as emergence of inherent and acquired drug resistance in cancer cells. As a common strategy to overcome drug resistance, higher doses of chemo-agents are administered.

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.