설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CGGACACAAATAGGCTCCTCTACACCTGAAGACAAAGGCAAAGTCAAATGGGGACCAGAATAAATCTTAGACCCCACAGTCCTTCCCATTTCCAGCCCTAATCTACAGACAGGAATGCCCTTCAGGTTTCTTCCCTCCCCCCTCTTGACCTACCCCAGATATTTGTGTGGAAGAGGAGGAATCACCATTTACAAGGTGGACAAATGCTAATATTTTTATCTAGAAAGAAGAGTGAGTGTTAACTTTTATTTTTTTCCTTCTGGGGGGTCTGTTGACTCCTTTCTTTTGGGTGCTGCCTATAAATCTTGGAGGAATCATTTCTCCTCCTCAAAAACTGATTCAGAAACTGACTTGGGGAAGGAATTTAATACTTTGAAGTCATGAGATGCACCATCGAGGCTACCCCCAAGAAGAAGCAGA
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... GFI1(2672) , GFI1(2672)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Cancer management and research, 10, 2849-2857 (2018-09-11)
The independent growth factor 1 (Gfi-1) is a transcription factor essential for several diverse hematopoietic functions and developments. However, the role and molecular mechanism of Gfi-1 in the development and progression of cervical cancer remains unclear. The present study investigates
Scientific reports, 7(1), 11148-11148 (2017-09-13)
Growth Factor Independence 1 (GFI1) is a transcriptional repressor that plays a critical role during both myeloid and lymphoid haematopoietic lineage commitment. Several studies have demonstrated the involvement of GFI1 in haematological malignancies and have suggested that low expression of
Molecular cancer research : MCR, 15(4), 405-417 (2017-01-26)
In multiple myeloma, osteolytic lesions rarely heal because of persistent suppressed osteoblast differentiation resulting in a high fracture risk. Herein, chromatin immunoprecipitation analyses reveal that multiple myeloma cells induce repressive epigenetic histone changes at the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.