콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU059281

Sigma-Aldrich

MISSION® esiRNA

targeting human TCF12

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

CCATCCTGGGCTTAGTGAAACTACCAACCCTATGGGTCATATGTAAACATCAGCCAGTTCCAGAGTTATCAGTAGGCTAGATAGAAGGTGACCTCTCCTCATAAGGACTTGGACAACTCAGATTATCTGAAGACACAAACCTGACAGGAGGGAGAAGAAAAAACAAAACACTTGAACCAAGAAACTCAAATGTAATCCTACGATCAAAGCAACTGGTCAACACTTCCATCAGAAGTGAAGATAGGAAGCTCATCAGATAGAACATCAGCCCATGAGATGTTTGCAACAAATCTTTTGTTGCAAGCAGTGTGTCGCTTCTGCACAATCAGAGACTGTCTCGATCTCTCCACTCACCGTGGAAGTTGCCTTGTGCCTAAACTGAATTGACAAATGCATTGTAACTACAAATTTTATTTATTGTTATGAAACTGTAAGGTCTACATATAAAGGGAAAAAGTTAATGTGGAAAGCTGATCTACACTCAGCTGATGCCA

Ensembl | 인체 수납 번호

ENSG00000140262

NCBI 수납 번호

NM_003205

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... TCF12(6938) , TCF12(6938)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

죄송합니다. 지금은 이 제품에 대한 COA이(가) 온라인에서 제공되지 않습니다.

도움이 필요하시면 연락하세요. 고객 지원 부서

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Paulo R D V Godoy et al.
Molecular medicine reports, 14(6), 5253-5260 (2016-10-26)
Glioblastoma multiforme (GBM) is a lethal tumor and novel strategies are required to overcome resistance. Transcription factor 12 (HEB) has been associated with neural and stem cell proliferation, is overexpressed in certain tumor types and is induced in irradiated U87MG cells.
Leila Pirhaji et al.
Nature communications, 8(1), 623-623 (2017-09-22)
The immense and growing repositories of transcriptional data may contain critical insights for developing new therapies. Current approaches to mining these data largely rely on binary classifications of disease vs. control, and are not able to incorporate measures of disease
Duo Wen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(8), 6211-6221 (2015-03-11)
Malic enzyme 1 (ME1) links the glycolytic and citric acid cycles and is important for NADPH production, glutamine metabolism, and lipogenesis. Recently, its deregulation has been implicated in the progression of various cancers. However, the role of ME1 in the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.