설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGTCAGCCAGAGATCACCAGAAGCTGGAGAGAGAGGCTCGGATCTGCCGCCTTCTGAAGCATTCCAACATCGTGCGTCTCCACGACAGCATCTCCGAGGAGGGCTTCCACTACCTGGTCTTCGATCTGGTCACTGGTGGGGAGCTCTTTGAAGACATTGTGGCGAGAGAGTACTACAGCGAGGCTGATGCCAGTCACTGTATCCAGCAGATCCTGGAGGCCGTTCTCCATTGTCACCAAATGGGGGTCGTCCACAGAGACCTCAAGCCGGAGAACCTGCTTCTGGCCAGCAAGTGCAAAGGGGCTGCAGTGAAGCTGGCAGACTTCGGCCTAGCTATCGAGGTGCAGGGGGACCAGCAGGCATGGTTTGGTTTCGCTGGCACACCAGGCTACCTGTCCCCTGAGGTCCTTCGCAAAGAG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... CAMK2B(816) , CAMK2B(816)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
Jianwei Li et al.
Nature communications, 10(1), 1589-1589 (2019-04-10)
Transmembrane and coiled-coil domains 1 (TMCO1) is a recently identified Ca2+ leak channel in the endoplasmic reticulum. TMCO1 dysfunction in humans is associated with dysmorphism, mental retardation, glaucoma and the occurrence of cancer. Here we show an essential role of
Sébastien Küry et al.
American journal of human genetics, 101(5), 768-788 (2017-11-04)
Calcium/calmodulin-dependent protein kinase II (CAMK2) is one of the first proteins shown to be essential for normal learning and synaptic plasticity in mice, but its requirement for human brain development has not yet been established. Through a multi-center collaborative study
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.