설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
GAACCTCCTGTGAGCGAGAGTGATGATGGCTTCAGCATACACAATGCTACACTGCAGTCACACACACTGGCAGACTCCATCCCCAGCAGCCCTGCTTCTTCACAGTTCTCTGTCTGTAGTGAGGATCAGGAAGCTATTCAGGCACAGAAAATTTGGAAGAAAGCCATCATGCTTGTATGGAGAGCTGCAGCTAATCATAGGTATGCCAATGTCTTCCTGCAGCCTGTTACAGATGACATAGCACCTGGCTACCACAGCATTGTGCAGAGGCCTATGGATTTGTCAACTATTAAGAAAAACATAGAAAATGGACTGATCCGAAGCACAGCTGAATTTCAGCGTGACATTATGCTGATGTTTCAGAATGCTGTAATGTACAATAGCTCAGACCATGATGTCTATCACATGGCAGTGGAGATG
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... BRD8(10902) , BRD8(10902)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Anahita Lashgari et al.
Scientific reports, 8(1), 14089-14089 (2018-09-22)
Regulation of the chromatin state is crucial for biological processes such as the regulation of transcription, DNA replication, and DNA damage repair. Here we show that knockdown of the BRD8 bromodomain protein - a subunit of the p400/Tip60 complex -
Changping Gu et al.
Respiratory research, 16, 58-58 (2015-05-20)
Ventilator-induced lung injury (VILI) is one of the most common complications for patients with acute lung injury (ALI) or acute respiratory distress syndrome (ARDS). Although p120 is an important protein in the regulation of cell junctions, further mechanisms should be
Tatsuyuki Matsudaira et al.
Journal of cell science, 128(16), 3131-3142 (2015-07-03)
The retrograde pathway is defined by the transport of proteins and lipids from the plasma membrane through endosomes to the Golgi complex, and is essential for a variety of cellular activities. Recycling endosomes are important sorting stations for some retrograde
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.