콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU058001

Sigma-Aldrich

MISSION® esiRNA

targeting human CLU

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GACTCTGCTGCTGTTTGTGGGGCTGCTGCTGACCTGGGAGAGTGGGCAGGTCCTGGGGGACCAGACGGTCTCAGACAATGAGCTCCAGGAAATGTCCAATCAGGGAAGTAAGTACGTCAATAAGGAAATTCAAAATGCTGTCAACGGGGTGAAACAGATAAAGACTCTCATAGAAAAAACAAACGAAGAGCGCAAGACACTGCTCAGCAACCTAGAAGAAGCCAAGAAGAAGAAAGAGGATGCCCTAAATGAGACCAGGGAATCAGAGACAAAGCTGAAGGAGCTCCCAGGAGTGTGCAATGAGACCATGATGGCCCTCTGGGAAGAGTGTAAGCCCTGCCTGAAACAGACCTGCATGAAGTTCTACGCACGCGTCTGCAGAAGTGGCTCAGGCCTGGTTGGCCGCCAGCTTGAGGAGTTCCTGAACCAGAGCTCGCCCTTCTAC

Ensembl | 인체 수납 번호

ENSG00000120885

NCBI 수납 번호

NM_001831

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... CLU(1191) , CLU(1191)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Na Fu et al.
Life sciences, 256, 117911-117911 (2020-06-07)
To explore the potential regulatory mechanism of differentially expressed mRNAs in Hepatitis C virus (HCV)-related hepatocellular carcinoma (HCC). Patients with HCV-related HCC and age- and gender-matched healthy subjects were enrolled. Differentially expressed mRNAs in the plasma were detected by digital
Alice Filippini et al.
Glia, 69(3), 681-696 (2020-10-13)
The progressive neuropathological damage seen in Parkinson's disease (PD) is thought to be related to the spreading of aggregated forms of α-synuclein. Clearance of extracellular α-synuclein released by degenerating neurons may be therefore a key mechanism to control the concentration
Jung-Yoon Heo et al.
The Journal of endocrinology, 237(2), 175-191 (2018-03-23)
Clusterin is a secretory glycoprotein that is involved in multiple physiopathological processes, including lipid metabolism. Previous studies have shown that clusterin prevents hepatic lipid accumulation via suppression of sterol regulatory element-binding protein (SREBP) 1. In this study, we examined the
Patricia M Schnepp et al.
Cancer research, 77(11), 2844-2856 (2017-04-13)
The impact of altered amino acid metabolism on cancer progression is not fully understood. We hypothesized that a metabolic transcriptome shift during metastatic evolution is crucial for brain metastasis. Here, we report a powerful impact in this setting caused by

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.