콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU055711

Sigma-Aldrich

MISSION® esiRNA

targeting human RBX1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

TGCAGGAACCACATTATGGATCTTTGCATAGAATGTCAAGCTAACCAGGCGTCCGCTACTTCAGAAGAGTGTACTGTCGCATGGGGAGTCTGTAACCATGCTTTTCACTTCCACTGCATCTCTCGCTGGCTCAAAACACGACAGGTGTGTCCATTGGACAACAGAGAGTGGGAATTCCAAAAGTATGGGCACTAGGAAAAGACTTCTTCCATCAAGCTTAATTGTTTTGTTATTCATTTAATGACTTTCCCTGCTGTTACCTAATTACAAATTGGATGGAACTGTGTTTTTTTCTGCTTTGTTTTTTCAGTTTGCTGTTTCTGTAGCCATATTGTATTCTGTGTCAAATAAAGTCCAGTTGGATTCTGGAACGGATG

Ensembl | 인체 수납 번호

ENSG00000100387

NCBI 수납 번호

NM_014248

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... RBX1(9978) , RBX1(9978)

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

적합한 제품을 찾을 수 없으신가요?  

당사의 제품 선택기 도구.을(를) 시도해 보세요.

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Tomohiro Kunishige et al.
Oncology letters, 20(3), 2919-2927 (2020-08-13)
Ring box protein-1 (RBX1) is an essential component of the S-phase kinase-associated protein, Cullin and F-box containing ubiquitin ligases. Overexpression of RBX1 has been reported in several cancer types; however, little is known regarding the prognostic value and role of
Kazuhiro Migita et al.
Gastric cancer : official journal of the International Gastric Cancer Association and the Japanese Gastric Cancer Association, 17(4), 601-609 (2013-12-03)
RING box protein-1 (RBX1) is an essential component of the E3 ubiquitin ligase Skp1/Cullin/RBX1/F-box protein complex. Although an altered expression of RBX1 has been reported in several human cancers, the role of RBX1 in gastric cancer remains unknown. We investigated
Fan Yao et al.
Nature communications, 9(1), 2269-2269 (2018-06-13)
Dysregulation of YAP localization and activity is associated with pathological conditions such as cancer. Although activation of the Hippo phosphorylation cascade is known to cause cytoplasmic retention and inactivation of YAP, emerging evidence suggests that YAP can be regulated in

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.