설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CTGTGGAAGGCTCTGGAAAGTCCTTCAAAGCTGGAGTCTGTCCTCCTAAGAAATCTGCCCAGTGCCTTAGATACAAGAAACCTGAGTGCCAGAGTGACTGGCAGTGTCCAGGGAAGAAGAGATGTTGTCCTGACACTTGTGGCATCAAATGCCTGGATCCTGTTGACACCCCAAACCCAACAAGGAGGAAGCCTGGGAAGTGCCCAGTGACTTATGGCCAATGTTTGATGCTTAACCCCCCCAATTTCTGTGAGATGGATGGCCAGTGCAAGCGTGACTTGAAGTGTTGCATGGGCATGTGTGGGAAATCCTGCGTTTCCCCTGTGAAAGCTTGATTCCTGCCATATGGAGGAGGCTCTGGAGTCCTGCTCTGTGTGGTCCAGGTCCTTT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... SLPI(6590) , SLPI(6590)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
적합한 제품을 찾을 수 없으신가요?
당사의 제품 선택기 도구.을(를) 시도해 보세요.
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Oncotarget, 7(46), 75800-75809 (2016-10-08)
Dendritic cells (DCs) are professional antigen presenting cells (APCs) that in response to microbial infections generate long-lasting adaptive immune response. Following microbial uptake, DCs undergo a cascade of cellular differentiation that ultimately leads to "mature" DCs. Mature DCs produce a
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 66(9), 823-831 (2017-06-10)
Regulation of immune-like cell properties of periodontal ligament (PDL) cells is not understood. We investigate the importance of secretory leukocyte protease inhibitor (SLPI) for production of pro-inflammatory cytokines in human PDL cells. PDL cells were isolated from teeth extracted for
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.