설명
Powered by Eupheria Biotech
제품 라인
MISSION®
형태
lyophilized powder
esiRNA cDNA 표적 서열
CTGAAGAGAGCGGAGAGGAACCAGAGGACTCAGAGCAGGCCTCGCCCTACCAGGTTGCATGGTCCATCCGGGAAACCCTCAGATATCAAAGACATGCGTCAGATGATGATGATGCGGAGAGTAGGAGCTCCAGGGTGACTCAACTTTGCACTTACTTTCAGCAGAAATATAAGCACCTCTGCCGCCTGGAGCGGGCAGAATCTCGTCAAAAGAAATGCCGGCATACGTTTAGGAAAGCTTTGCTGCAGGCGGCCAGTAAAGAACCAGAATGCACTGGTCAGTTAATACAAGAACTGCGGAGAGCTGCATGCAGTCGAACCAGCATAAGCCGGACCAAGCTGAGGGAGGTGGAACCAGCAGCATGCAGTGGAACCGTGAAGGGTGAACAGTGCGCTAACAA
Ensembl | 인체 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... INO80D(54891) , INO80D(54891)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
시험 성적서(COA)
제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.
Chun-Chi Chang et al.
International journal of oncology, 53(1), 417-433 (2018-05-12)
Long non‑coding RNAs (lncRNAs) have various functions, including chromatin remodeling and the regulation of gene expression at the transcriptional and post-transcriptional levels. However, few lncRNAs have been investigated comprehensively, with the majority being uncharacterized. In the present study, a bioinformatics
Gabriel G Malouf et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(15), 4129-4140 (2014-06-06)
MITF/TFE translocation renal cell carcinoma (TRCC) is a rare subtype of kidney cancer. Its incidence and the genome-wide characterization of its genetic origin have not been fully elucidated. We performed RNA and exome sequencing on an exploratory set of TRCC
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.