콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU054741

Sigma-Aldrich

MISSION® esiRNA

targeting human PRKD1

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AGCTTCTGAAGGGGCTTTTCAGGCAGGGCTTGCAGTGCAAAGATTGCAGATTCAACTGCCATAAACGTTGTGCACCGAAAGTACCAAACAACTGCCTTGGCGAAGTGACCATTAATGGAGATTTGCTTAGCCCTGGGGCAGAGTCTGATGTGGTCATGGAAGAAGGGAGTGATGACAATGATAGTGAAAGGAACAGTGGGCTCATGGATGATATGGAAGAAGCAATGGTCCAAGATGCAGAGATGGCAATGGCAGAGTGCCAGAACGACAGTGGCGAGATGCAAGATCCAGACCCAGACCACGAGGACGCCAACAGAACCATCAGTCCATCAACAAGCAACAATATCCCACTCATGAGGGTAGTGCAGTCTGTCAAACACACGAAGAGGAAAAGCAGCAC

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Kimberly A Coughlan et al.
The Journal of biological chemistry, 291(11), 5664-5675 (2016-01-23)
AMP-activated protein kinase (AMPK) is an energy-sensing enzyme whose activity is inhibited in settings of insulin resistance. Exposure to a high glucose concentration has recently been shown to increase phosphorylation of AMPK at Ser(485/491) of its α1/α2 subunit; however, the
Qi Zhou et al.
Archives of toxicology, 93(6), 1639-1648 (2019-04-26)
2,3',4,4',5-Pentachlorobiphenyl (PCB118) has been shown to cause thyroidal ultrastructure lesions, but the underlying mechanism remains elusive. This study aimed to elucidate the mechanism by which PCB118 induces the abnormalities of the thyrocytes. Wistar rats were injected intraperitoneally with PCB118 (0
Jonathan Baker et al.
PloS one, 13(4), e0195864-e0195864 (2018-04-14)
Many catabolic stimuli, including interleukin-1 (IL-1) in combination with oncostatin M (OSM), promote cartilage breakdown via the induction of collagen-degrading collagenases such as matrix metalloproteinase 1 (MMP1) and MMP13 in human articular chondrocytes. Indeed, joint diseases with an inflammatory component
Di Zhao et al.
International journal of biological sciences, 13(3), 276-285 (2017-04-04)
Growing evidence shows that protein kinase D (PKD) plays an important role in the development of pressure overload-induced cardiac hypertrophy. However, the mechanisms involved are not clear. This study tested our hypothesis that PKD might mediate cardiac hypertrophy by negatively
Jia Wang et al.
American journal of physiology. Cell physiology, 310(7), C542-C557 (2016-01-08)
Given the fundamental role of β-catenin signaling in intestinal epithelial cell proliferation and the growth-promoting function of protein kinase D1 (PKD1) in these cells, we hypothesized that PKDs mediate cross talk with β-catenin signaling. The results presented here provide several

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.