콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU054511

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP2

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

AAGCATGGCCTGTACAACCTCAAACAGTGCAAGATGTCTCTGAACGGGCAGCGTGGGGAGTGCTGGTGTGTGAACCCCAACACCGGGAAGCTGATCCAGGGAGCCCCCACCATCCGGGGGGACCCCGAGTGTCATCTCTTCTACAATGAGCAGCAGGAGGCTCGCGGGGTGCACACCCAGCGGATGCAGTAGACCGCAGCCAGCCGGTGCCTGGCGCCCCTGCCCCCCGCCCCTCTCCAAACACCGGCAGAAAACGGAGAGTGCTTGGGTGGTGGGTGCTGGAGGATTTTCCAGTTCTGACACACGTATTTATATTTGGAAAGAGACCAGCACCGAGCTCGGCACCTCCCCGGCCTCTCTCTTCCCAGCTGCAGATGCCACACCTGCTCCTTCTTGCTTT

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Z-S Yuan et al.
European review for medical and pharmacological sciences, 21(22), 5072-5080 (2017-12-12)
Gliomas are accompanied with high mortality owning to their invasive peculiarity and vulnerability to drug resistance. miR-21 is a vital oncogenic miRNA that regulates drug resistance of tumor cells. This study aims to elucidate the function of miR-21 in human
Hiromichi Katayama et al.
Scientific reports, 7(1), 12016-12016 (2017-09-22)
Renal cell carcinoma (RCC) is one of the most lethal urologic cancers. About one-third of RCC patients already have distal metastasis at the time of diagnosis. There is growing evidence that Hox antisense intergenic RNA (HOTAIR) plays essential roles in
S W Yau et al.
International journal of obesity (2005), 39(5), 770-781 (2014-11-06)
IGF-binding protein (IGFBP)-2 is the principal IGFBP produced by white adipocytes during adipogenesis, and circulating levels are reduced in obesity. Overexpression of IGFBP-2 in transgenic mice prevents obesity, but depot-specific effects of IGFBP-2 on adipo/lipogenesis are unknown. The present study
Steven W Yau et al.
Endocrinology, 155(6), 2133-2143 (2014-03-25)
Leptin is produced from white adipose tissue and acts primarily to regulate energy balance. Obesity is associated with leptin resistance and increased circulating levels of leptin. Leptin has recently been shown to influence levels of IGF binding protein-2 (IGFBP-2), a

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.