설명
Powered by Eupheria Biotech
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CCTGGCACTGGTCAATTCTTTGTGATGATGTCACCACAAGAAGTACTGCAGGGAGGAAGCCAGCGCTCAATTGCCCCTAGGACTCACCCTTATTCCCCGAAGTCAGAAGCTCCCCGGACGACTCGGGATGAGAAACGCAGGGCTCAGCATAATGAAGTGGAGCGTCGCCGCCGAGACAAGATCAACAACTGGATCGTGCAGCTCTCCAAGATAATCCCAGACTGCTCTATGGAGAGCACCAAGTCTGGCCAGAGTAAAGGTGGGATTCTATCCAAAGCTTGTGATTATATCCAGGAGCTTCGGCAGAGTAACCACCGCTTGTCTGAAGAACTGCAGGGACTTGACCAACTGCAGCTGGACAATGACGTGCTTCGACAACAGGTGGAAGATCTTAAAAACAAGAATCTGCTGCTTCGAGCTCAGTTGCGGCACCACGGATTAGAGGTCGT
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... USF1(7391) , USF1(7391)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Xiangxiang Liu et al.
Molecular therapy. Nucleic acids, 22, 750-765 (2020-11-25)
Hepatocellular carcinoma (HCC), one of the most aggressive malignancies, ranks as the fourth leading cause of cancer-related deaths worldwide. Emerging evidence indicates that RNA N6-methyladenosine (m6A) plays a critical role in tumor progression. However, the biological function of YTHDF1 in
Xiu-Juan Ding et al.
Theranostics, 10(24), 11110-11126 (2020-10-13)
Rationale: Many external factors can induce the melanogenesis and inflammation of the skin. Salidroside (SAL) is the main active ingredient of Rhodiola, which is a perennial grass plant of the Family Crassulaceae. This study evaluated the effect and molecular mechanism
Jun Guo et al.
FEBS letters, 592(16), 2725-2738 (2018-07-29)
Previous studies indicate that the transcription factor upstream stimulating factor 1 (USF1) is involved in the regulation of lipid and glucose metabolism. However, the role of USF1 in lipid-induced autophagy remains unknown. Interestingly, we found that USF1 overexpression suppresses autophagy-related
Chunyu Cao et al.
International journal of cancer, 143(6), 1388-1401 (2018-04-11)
Our recent studies have shown that cross-talk between histone deacetylase 5 (HDAC5) and lysine-specific demethylase 1 (LSD1) facilitates breast cancer progression. In this work, we demonstrated that regulatory activity at -356 to -100 bp promoter element plays a critical role
Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.