콘텐츠로 건너뛰기
Merck
모든 사진(1)

주요 문서

EHU053371

Sigma-Aldrich

MISSION® esiRNA

targeting human SYP

로그인조직 및 계약 가격 보기


About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

제품 라인

MISSION®

양식

lyophilized powder

esiRNA cDNA 표적 서열

ACCGAGAGTGACCTCAGCATCGAGGTCGAGTTCGAGTACCCCTTCAGGCTGCACCAAGTGTACTTTGATGCACCCACCTGCCGAGGGGGCACCACCAAGGTCTTCTTAGTTGGGGACTACTCCTCGTCAGCCGAATTCTTTGTCACCGTGGCCGTGTTTGCCTTCCTCTACTCCATGGGGGCTCTGGCCACCTACATCTTCCTGCAGAACAAGTACCGAGAGAATAACAAAGGGCCCATGCTGGACTTTCTGGCCACGGCTGTGTTCGCCTTCATGTGGCTAGTTAGCTCATCGGCATGGGCCAAGGGGCTGTCAGATGTGAAGATGGCCACAGACCCAGAGAACATTATCAAGGAGATGCCTGTCTGCCGCCAGACAGGGAACACATGCAAGGAGCTGA

Ensembl | 인체 수납 번호

NCBI 수납 번호

배송 상태

ambient

저장 온도

−20°C

유전자 정보

일반 설명

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable


가장 최신 버전 중 하나를 선택하세요:

시험 성적서(COA)

Lot/Batch Number

적합한 버전을 찾을 수 없으신가요?

특정 버전이 필요한 경우 로트 번호나 배치 번호로 특정 인증서를 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Teng-Fei Li et al.
Scientific reports, 7, 45056-45056 (2017-03-23)
Bulleyaconitine (BAA) has been shown to possess antinociceptive activities by stimulation of dynorphin A release from spinal microglia. This study investigated its underlying signal transduction mechanisms. The data showed that (1) BAA treatment induced phosphorylation of CREB (rather than NF-κB)
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
Xi-Xi Lin et al.
Toxicology mechanisms and methods, 24(8), 575-583 (2014-08-20)
Cigarette smoke contains reactive oxygen (ROS) that can cause oxidative stress. It increases the number of apoptotic and necrotic lung cells and further induces the development of chronic airway disease. In this study, we investigated the effects of cigarette smoke
Xiaochun Yang et al.
Oncotarget, 6(8), 6203-6217 (2015-03-10)
Liver dysfunction is a common side effect associated with the treatment of dasatinib and its mechanism is poorly understood. Autophagy has been thought to be a potent survival or death factor for liver dysfunction, which may shed the light on
Bruce C McGorum et al.
Molecular & cellular proteomics : MCP, 14(11), 3072-3086 (2015-09-15)
Equine grass sickness (EGS) is an acute, predominantly fatal, multiple system neuropathy of grazing horses with reported incidence rates of ∼2%. An apparently identical disease occurs in multiple species, including but not limited to cats, dogs, and rabbits. Although the

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.