설명
Powered by Eupheria Biotech
Quality Level
제품 라인
MISSION®
양식
lyophilized powder
esiRNA cDNA 표적 서열
CAGTGGATGGTCACTGTGCTCTAGAATCCAAATACGTGAAGACTGTGTGCTTGCCTGATGGGTCCTTTCCCTCTGGGAGTGAGTGCCACATCTCTGGCTGGGGTGTTACAGAAACAGGAAAAGGGTCCCGCCAGCTCCTGGATGCCAAAGTCAAGCTGATTGCCAACACTTTGTGCAACTCCCGCCAACTCTATGACCACATGATTGATGACAGTATGATCTGTGCAGGAAATCTTCAGAAACCTGGGCAAGACACCTGCCAGGGTGACTCTGGAGGCCCCCTGACCTGTGAGAAGGACGGCACCTACTACGTCTATGGGATAGTGAGCTGGGGCCTGGAGTGTGGGAAGAGGCCAGGGGTCTACACCCAAGTTACCAAATTCCTGAATTGGATCAAAGCC
Ensembl | 인체 수납 번호
NCBI 수납 번호
배송 상태
ambient
저장 온도
−20°C
유전자 정보
human ... HABP2(3026) , HABP2(3026)
일반 설명
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
법적 정보
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point (°F)
Not applicable
Flash Point (°C)
Not applicable
가장 최신 버전 중 하나를 선택하세요:
Sudheer Kumar Gara et al.
The New England journal of medicine, 373(5), 448-455 (2015-07-30)
Familial nonmedullary thyroid cancer accounts for 3 to 9% of all cases of thyroid cancer, but the susceptibility genes are not known. Here, we report a germline variant of HABP2 in seven affected members of a kindred with familial nonmedullary
Tamara Mirzapoiazova et al.
Frontiers in oncology, 5, 164-164 (2015-08-11)
Lung cancer is a devastating disease with limited treatment options. Many lung cancers have changes in their microenvironment including upregulation of the extracellular matrix glycosaminoglycan, hyaluronan (HA), which we have previously demonstrated can regulate the activity of the extracellular serine
자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..
고객지원팀으로 연락바랍니다.